Mutagenetix > Incidental Mutation

Incidental Mutation 'R1233:Arhgap45'

152356

Institutional Source

Beutler Lab

Gene Symbol

Arhgap45

Ensembl Gene

ENSMUSG00000035697

Gene Name

Rho GTPase activating protein 45

Synonyms

6330406L22Rik, Hmha1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1233 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79852505-79867305 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79863416 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 753 (I753T)

Ref Sequence

ENSEMBL: ENSMUSP00000101012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043311
AA Change: I626T

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: I626T

Domain	Start	End	E-Value	Type
low complexity region	142	153	N/A	INTRINSIC
FCH	157	244	4.14e-17	SMART
low complexity region	255	269	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	330	345	N/A	INTRINSIC
low complexity region	527	536	N/A	INTRINSIC
C1	582	628	3.15e-8	SMART
RhoGAP	653	852	2.73e-73	SMART
low complexity region	856	869	N/A	INTRINSIC
Blast:RhoGAP	876	999	1e-21	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000099501
AA Change: I742T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: I742T

Domain	Start	End	E-Value	Type
low complexity region	258	269	N/A	INTRINSIC
FCH	273	360	4.14e-17	SMART
low complexity region	371	385	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	446	461	N/A	INTRINSIC
low complexity region	643	652	N/A	INTRINSIC
C1	698	744	3.15e-8	SMART
RhoGAP	769	968	2.73e-73	SMART
low complexity region	972	985	N/A	INTRINSIC
Blast:RhoGAP	992	1115	1e-21	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000105373
AA Change: I753T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: I753T

Domain	Start	End	E-Value	Type
low complexity region	269	280	N/A	INTRINSIC
FCH	284	371	4.14e-17	SMART
low complexity region	382	396	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	457	472	N/A	INTRINSIC
low complexity region	654	663	N/A	INTRINSIC
C1	709	755	3.15e-8	SMART
RhoGAP	780	979	2.73e-73	SMART
low complexity region	983	996	N/A	INTRINSIC
Blast:RhoGAP	1003	1126	1e-21	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150022

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 95.9%
20x: 90.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	A	G	5: 137,288,419 (GRCm39)		probably null	Het
Aopep	T	A	13: 63,347,334 (GRCm39)	M631K	probably damaging	Het
Arfgef1	T	C	1: 10,254,315 (GRCm39)	D773G	probably damaging	Het
Cd274	T	A	19: 29,351,301 (GRCm39)		probably null	Het
Cdh16	C	T	8: 105,345,114 (GRCm39)	A392T	possibly damaging	Het
Csmd3	T	C	15: 48,536,927 (GRCm39)	T92A	probably damaging	Het
Exosc8	A	T	3: 54,639,419 (GRCm39)	C129S	probably benign	Het
Fat3	T	G	9: 15,834,041 (GRCm39)	I4184L	probably benign	Het
Frem2	A	G	3: 53,455,199 (GRCm39)	Y2126H	probably damaging	Het
Fsbp	T	C	4: 11,580,053 (GRCm39)	M107T	possibly damaging	Het
Gper1	A	G	5: 139,412,357 (GRCm39)	Y234C	probably damaging	Het
Hmcn1	T	C	1: 150,624,777 (GRCm39)	S1043G	probably benign	Het
Kif2a	T	A	13: 107,123,840 (GRCm39)	K137N	probably damaging	Het
Mrc2	T	C	11: 105,239,241 (GRCm39)	F1332S	probably damaging	Het
Nme8	T	A	13: 19,844,682 (GRCm39)	M375L	possibly damaging	Het
Or1e32	T	A	11: 73,705,176 (GRCm39)	H244L	probably damaging	Het
Per1	T	C	11: 68,993,037 (GRCm39)	L298P	probably damaging	Het
Polr2b	A	G	5: 77,482,412 (GRCm39)	N650S	probably benign	Het
Ppara	T	C	15: 85,682,222 (GRCm39)	V306A	probably damaging	Het
Rem1	G	A	2: 152,476,455 (GRCm39)	V238M	probably damaging	Het
Repin1	A	G	6: 48,574,768 (GRCm39)	T566A	possibly damaging	Het
Rhot2	T	A	17: 26,063,071 (GRCm39)	D57V	probably damaging	Het
Samd4b	C	T	7: 28,113,435 (GRCm39)	G177R	probably damaging	Het
Slc5a8	C	A	10: 88,754,304 (GRCm39)	P435H	probably damaging	Het
Stpg1	G	A	4: 135,252,740 (GRCm39)	A164T	probably benign	Het
Tll2	G	T	19: 41,084,423 (GRCm39)	A668D	possibly damaging	Het
Txnl1	T	A	18: 63,808,539 (GRCm39)	M180L	probably benign	Het
Vopp1	A	C	6: 57,766,980 (GRCm39)	L32R	probably damaging	Het
Wdr95	C	T	5: 149,505,323 (GRCm39)	T226I	possibly damaging	Het
Wdr95	C	A	5: 149,518,829 (GRCm39)	Q557K	probably benign	Het

Other mutations in Arhgap45

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Arhgap45	APN	10	79,864,482 (GRCm39)	splice site	probably benign
IGL01414:Arhgap45	APN	10	79,862,938 (GRCm39)	missense	probably damaging	1.00
IGL01505:Arhgap45	APN	10	79,862,376 (GRCm39)	missense	probably benign	0.10
IGL02203:Arhgap45	APN	10	79,863,387 (GRCm39)	nonsense	probably null
IGL02557:Arhgap45	APN	10	79,857,472 (GRCm39)	missense	probably damaging	1.00
IGL02858:Arhgap45	APN	10	79,853,768 (GRCm39)	missense	probably benign	0.20
IGL03292:Arhgap45	APN	10	79,856,803 (GRCm39)	missense	probably benign	0.04
IGL03352:Arhgap45	APN	10	79,866,585 (GRCm39)	missense	probably damaging	0.96
Celt	UTSW	10	79,856,652 (GRCm39)	missense	probably damaging	1.00
celtic	UTSW	10	79,863,423 (GRCm39)	nonsense	probably null
druid	UTSW	10	79,862,181 (GRCm39)	critical splice donor site	probably null
Mistletoe	UTSW	10	79,862,936 (GRCm39)	nonsense	probably null
Roman	UTSW	10	79,863,431 (GRCm39)	missense	probably damaging	1.00
stonehenge	UTSW	10	79,861,316 (GRCm39)	missense	possibly damaging	0.81
IGL03048:Arhgap45	UTSW	10	79,852,851 (GRCm39)	missense	probably damaging	0.99
PIT4677001:Arhgap45	UTSW	10	79,856,583 (GRCm39)	missense	probably benign
R0532:Arhgap45	UTSW	10	79,857,917 (GRCm39)	missense	possibly damaging	0.92
R1579:Arhgap45	UTSW	10	79,864,811 (GRCm39)	missense	probably damaging	1.00
R1666:Arhgap45	UTSW	10	79,864,584 (GRCm39)	missense	possibly damaging	0.82
R1668:Arhgap45	UTSW	10	79,864,584 (GRCm39)	missense	possibly damaging	0.82
R1688:Arhgap45	UTSW	10	79,864,929 (GRCm39)	missense	probably damaging	1.00
R1710:Arhgap45	UTSW	10	79,853,932 (GRCm39)	nonsense	probably null
R1902:Arhgap45	UTSW	10	79,861,300 (GRCm39)	missense	probably damaging	0.99
R1912:Arhgap45	UTSW	10	79,856,524 (GRCm39)	missense	probably benign	0.08
R1935:Arhgap45	UTSW	10	79,866,788 (GRCm39)	missense	probably damaging	1.00
R1936:Arhgap45	UTSW	10	79,866,788 (GRCm39)	missense	probably damaging	1.00
R1955:Arhgap45	UTSW	10	79,862,326 (GRCm39)	missense	probably benign	0.15
R1968:Arhgap45	UTSW	10	79,863,536 (GRCm39)	missense	probably damaging	1.00
R1977:Arhgap45	UTSW	10	79,856,652 (GRCm39)	missense	probably damaging	1.00
R1986:Arhgap45	UTSW	10	79,856,530 (GRCm39)	missense	probably damaging	1.00
R2074:Arhgap45	UTSW	10	79,863,014 (GRCm39)	missense	probably damaging	1.00
R2081:Arhgap45	UTSW	10	79,863,508 (GRCm39)	missense	probably damaging	1.00
R2162:Arhgap45	UTSW	10	79,852,813 (GRCm39)	start codon destroyed	probably null	0.02
R2937:Arhgap45	UTSW	10	79,864,836 (GRCm39)	missense	probably damaging	1.00
R2938:Arhgap45	UTSW	10	79,864,836 (GRCm39)	missense	probably damaging	1.00
R3081:Arhgap45	UTSW	10	79,862,281 (GRCm39)	missense	probably damaging	1.00
R4695:Arhgap45	UTSW	10	79,861,364 (GRCm39)	missense	probably damaging	1.00
R4736:Arhgap45	UTSW	10	79,862,006 (GRCm39)	missense	probably damaging	1.00
R4758:Arhgap45	UTSW	10	79,866,127 (GRCm39)	missense	probably benign	0.00
R4860:Arhgap45	UTSW	10	79,862,900 (GRCm39)	missense	probably damaging	1.00
R4860:Arhgap45	UTSW	10	79,862,900 (GRCm39)	missense	probably damaging	1.00
R4934:Arhgap45	UTSW	10	79,856,791 (GRCm39)	missense	probably damaging	1.00
R4943:Arhgap45	UTSW	10	79,862,337 (GRCm39)	missense	probably benign	0.00
R5102:Arhgap45	UTSW	10	79,857,262 (GRCm39)	missense	probably benign	0.01
R5128:Arhgap45	UTSW	10	79,866,793 (GRCm39)	missense	probably benign	0.16
R5667:Arhgap45	UTSW	10	79,861,310 (GRCm39)	missense	probably damaging	1.00
R5671:Arhgap45	UTSW	10	79,861,310 (GRCm39)	missense	probably damaging	1.00
R5920:Arhgap45	UTSW	10	79,864,965 (GRCm39)	missense	possibly damaging	0.87
R5998:Arhgap45	UTSW	10	79,866,784 (GRCm39)	missense	probably damaging	0.99
R6276:Arhgap45	UTSW	10	79,862,068 (GRCm39)	missense	probably benign	0.25
R6675:Arhgap45	UTSW	10	79,853,938 (GRCm39)	missense	probably null	0.98
R6738:Arhgap45	UTSW	10	79,863,431 (GRCm39)	missense	probably damaging	1.00
R6783:Arhgap45	UTSW	10	79,853,698 (GRCm39)	missense	possibly damaging	0.92
R6863:Arhgap45	UTSW	10	79,853,616 (GRCm39)	missense	probably benign	0.03
R6978:Arhgap45	UTSW	10	79,857,682 (GRCm39)	missense	probably benign	0.00
R7089:Arhgap45	UTSW	10	79,862,181 (GRCm39)	critical splice donor site	probably null
R7215:Arhgap45	UTSW	10	79,861,316 (GRCm39)	missense	possibly damaging	0.81
R7307:Arhgap45	UTSW	10	79,865,016 (GRCm39)	missense	probably benign	0.14
R7308:Arhgap45	UTSW	10	79,862,392 (GRCm39)	critical splice donor site	probably null
R7480:Arhgap45	UTSW	10	79,862,936 (GRCm39)	nonsense	probably null
R7481:Arhgap45	UTSW	10	79,858,134 (GRCm39)	missense	possibly damaging	0.80
R7649:Arhgap45	UTSW	10	79,866,835 (GRCm39)	missense	probably benign	0.00
R7652:Arhgap45	UTSW	10	79,864,672 (GRCm39)	missense	probably benign	0.01
R7748:Arhgap45	UTSW	10	79,852,766 (GRCm39)	unclassified	probably benign
R7883:Arhgap45	UTSW	10	79,863,423 (GRCm39)	nonsense	probably null
R8121:Arhgap45	UTSW	10	79,853,909 (GRCm39)	missense	probably damaging	0.99
R8169:Arhgap45	UTSW	10	79,863,706 (GRCm39)	missense	probably damaging	1.00
R8170:Arhgap45	UTSW	10	79,863,706 (GRCm39)	missense	probably damaging	1.00
R8175:Arhgap45	UTSW	10	79,863,706 (GRCm39)	missense	probably damaging	1.00
R8178:Arhgap45	UTSW	10	79,863,706 (GRCm39)	missense	probably damaging	1.00
R8186:Arhgap45	UTSW	10	79,863,706 (GRCm39)	missense	probably damaging	1.00
R8187:Arhgap45	UTSW	10	79,863,706 (GRCm39)	missense	probably damaging	1.00
R8687:Arhgap45	UTSW	10	79,852,621 (GRCm39)	unclassified	probably benign
R8866:Arhgap45	UTSW	10	79,853,750 (GRCm39)	missense	probably damaging	1.00
R8905:Arhgap45	UTSW	10	79,855,570 (GRCm39)	missense	probably benign	0.00
R9299:Arhgap45	UTSW	10	79,862,565 (GRCm39)	missense	possibly damaging	0.82
R9412:Arhgap45	UTSW	10	79,855,564 (GRCm39)	start codon destroyed	probably null	0.66
R9579:Arhgap45	UTSW	10	79,853,843 (GRCm39)	missense	probably benign
R9629:Arhgap45	UTSW	10	79,863,694 (GRCm39)	missense	probably damaging	1.00
R9710:Arhgap45	UTSW	10	79,857,635 (GRCm39)	missense	probably damaging	0.99
X0023:Arhgap45	UTSW	10	79,866,634 (GRCm39)	missense	probably damaging	0.98
X0063:Arhgap45	UTSW	10	79,866,190 (GRCm39)	missense	possibly damaging	0.51
Z1176:Arhgap45	UTSW	10	79,864,886 (GRCm39)	missense	probably damaging	0.99
Z1176:Arhgap45	UTSW	10	79,861,370 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCATCACGGATCAGGACTGAGG -3'
(R):5'- CACTAAACCGCTCTTTTCCCAGGAC -3'

Sequencing Primer
(F):5'- agcaagtctgagccaacc -3'
(R):5'- ACCTCACCTTGGTGTGCAG -3'

Posted On

2014-01-29