Incidental Mutation 'R1233:Olfr392'
ID152359
Institutional Source Beutler Lab
Gene Symbol Olfr392
Ensembl Gene ENSMUSG00000061984
Gene Nameolfactory receptor 392
SynonymsGA_x6K02T2P1NL-3966976-3966038, MOR135-9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1233 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73811740-73817049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73814350 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 244 (H244L)
Ref Sequence ENSEMBL: ENSMUSP00000123649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118463] [ENSMUST00000144724]
Predicted Effect probably damaging
Transcript: ENSMUST00000118463
AA Change: H244L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113118
Gene: ENSMUSG00000061984
AA Change: H244L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.6e-6 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144724
AA Change: H244L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123649
Gene: ENSMUSG00000061984
AA Change: H244L

DomainStartEndE-ValueType
Pfam:7tm_1 41 116 2e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,199,520 M631K probably damaging Het
Ache A G 5: 137,290,157 probably null Het
Arfgef1 T C 1: 10,184,090 D773G probably damaging Het
Arhgap45 T C 10: 80,027,582 I753T probably damaging Het
Cd274 T A 19: 29,373,901 probably null Het
Cdh16 C T 8: 104,618,482 A392T possibly damaging Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Exosc8 A T 3: 54,731,998 C129S probably benign Het
Fat3 T G 9: 15,922,745 I4184L probably benign Het
Frem2 A G 3: 53,547,778 Y2126H probably damaging Het
Fsbp T C 4: 11,580,053 M107T possibly damaging Het
Gper1 A G 5: 139,426,602 Y234C probably damaging Het
Hmcn1 T C 1: 150,749,026 S1043G probably benign Het
Kif2a T A 13: 106,987,332 K137N probably damaging Het
Mrc2 T C 11: 105,348,415 F1332S probably damaging Het
Nme8 T A 13: 19,660,512 M375L possibly damaging Het
Per1 T C 11: 69,102,211 L298P probably damaging Het
Polr2b A G 5: 77,334,565 N650S probably benign Het
Ppara T C 15: 85,798,021 V306A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Repin1 A G 6: 48,597,834 T566A possibly damaging Het
Rhot2 T A 17: 25,844,097 D57V probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Slc5a8 C A 10: 88,918,442 P435H probably damaging Het
Stpg1 G A 4: 135,525,429 A164T probably benign Het
Tll2 G T 19: 41,095,984 A668D possibly damaging Het
Txnl1 T A 18: 63,675,468 M180L probably benign Het
Vopp1 A C 6: 57,789,995 L32R probably damaging Het
Wdr95 C T 5: 149,581,858 T226I possibly damaging Het
Wdr95 C A 5: 149,595,364 Q557K probably benign Het
Other mutations in Olfr392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr392 APN 11 73814786 missense probably damaging 0.97
IGL02976:Olfr392 APN 11 73814317 missense probably damaging 0.98
IGL03344:Olfr392 APN 11 73814177 missense probably benign 0.21
R0196:Olfr392 UTSW 11 73814905 missense probably damaging 0.99
R0347:Olfr392 UTSW 11 73814311 missense probably damaging 0.98
R0594:Olfr392 UTSW 11 73814617 missense probably benign 0.12
R0940:Olfr392 UTSW 11 73814224 missense probably damaging 1.00
R1300:Olfr392 UTSW 11 73814246 missense probably benign 0.13
R1490:Olfr392 UTSW 11 73814371 missense possibly damaging 0.95
R3111:Olfr392 UTSW 11 73814186 missense probably benign
R4827:Olfr392 UTSW 11 73814721 nonsense probably null
R4852:Olfr392 UTSW 11 73814248 missense probably benign 0.11
R4992:Olfr392 UTSW 11 73814320 missense probably damaging 1.00
R6193:Olfr392 UTSW 11 73814824 missense probably benign
R7201:Olfr392 UTSW 11 73814341 missense probably benign 0.19
R7310:Olfr392 UTSW 11 73814286 missense probably damaging 0.98
X0021:Olfr392 UTSW 11 73814305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCAAGTGCTACCATTACAGAGAG -3'
(R):5'- GACTATATTCCATGCCCTGCTGCATAC -3'

Sequencing Primer
(F):5'- TTGAGCATGGGAGTCACCAA -3'
(R):5'- ATACCCTACTCACGGCTAGATTG -3'
Posted On2014-01-29