Incidental Mutation 'R1234:Psg18'
ID 152383
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
MMRRC Submission 039302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R1234 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18349190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 347 (S347T)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably damaging
Transcript: ENSMUST00000003597
AA Change: S347T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: S347T

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098783
AA Change: S226T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: S226T

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183222
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Cd300e T A 11: 115,055,366 I90F probably damaging Het
Cyr61 A G 3: 145,649,839 probably benign Het
Dclk1 T C 3: 55,489,877 I528T probably damaging Het
Dnajc13 T C 9: 104,214,157 N645S possibly damaging Het
Efhb A T 17: 53,451,587 Y340* probably null Het
Fhod1 T C 8: 105,337,163 probably benign Het
Hk2 G A 6: 82,760,248 H28Y possibly damaging Het
Hmcn1 G A 1: 150,753,654 R951* probably null Het
Mapkapk2 G A 1: 131,055,776 R334* probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ptk6 C T 2: 181,202,440 R22Q possibly damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Ssrp1 T C 2: 85,042,263 F415S probably damaging Het
Stab1 A G 14: 31,150,236 L1198P probably damaging Het
Tcf23 T C 5: 30,970,222 Y123H probably damaging Het
Vars2 T C 17: 35,667,146 N43S probably damaging Het
Vmn2r79 A T 7: 87,004,099 E524V possibly damaging Het
Xrcc1 T C 7: 24,567,845 V373A possibly damaging Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
R9442:Psg18 UTSW 7 18349260 nonsense probably null
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGCAAGTGCCCAAATACCAATGTG -3'
(R):5'- AGAATGCAGGTCACCATCTTTCCAC -3'

Sequencing Primer
(F):5'- TACCAATGTGATGAAAAATGCAGTG -3'
(R):5'- ATTGATCCAGTGCCACGG -3'
Posted On 2014-01-29