Incidental Mutation 'R1235:Nmur1'
ID152397
Institutional Source Beutler Lab
Gene Symbol Nmur1
Ensembl Gene ENSMUSG00000026237
Gene Nameneuromedin U receptor 1
SynonymsGpr66, NMU1R, NmU-R, FM-3
MMRRC Submission 039303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1235 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location86386303-86426228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86386693 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 307 (G307S)
Ref Sequence ENSEMBL: ENSMUSP00000148767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027440] [ENSMUST00000212058] [ENSMUST00000212541] [ENSMUST00000212614]
Predicted Effect probably damaging
Transcript: ENSMUST00000027440
AA Change: G284S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027440
Gene: ENSMUSG00000026237
AA Change: G284S

DomainStartEndE-ValueType
Pfam:7tm_4 40 231 4.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 48 349 2.6e-8 PFAM
Pfam:7tm_1 54 334 7.8e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212058
AA Change: G307S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212541
AA Change: G251S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212614
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are healthy and viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsg T C 11: 109,534,107 probably null Het
Col6a1 C A 10: 76,712,324 A633S unknown Het
Dnajb3 C T 1: 88,205,479 R67H probably benign Het
Fam53c T A 18: 34,768,258 L76Q probably damaging Het
Gys2 A T 6: 142,430,293 Y548N probably damaging Het
Kcnh3 T A 15: 99,242,103 probably null Het
Lrp2 C T 2: 69,524,036 V483I probably damaging Het
Myom3 A T 4: 135,789,543 Y808F probably benign Het
Olfr1132 T G 2: 87,634,815 probably null Het
Pcdhb13 T C 18: 37,444,959 *797Q probably null Het
Plcb4 G A 2: 135,972,948 G719R probably damaging Het
Pld1 A T 3: 28,028,734 T143S probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sema5a A T 15: 32,609,226 Y426F probably benign Het
Trpc7 G T 13: 56,887,539 H194N probably damaging Het
Vmn2r106 A T 17: 20,279,479 F165I probably benign Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zp2 A T 7: 120,138,343 F240I possibly damaging Het
Other mutations in Nmur1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nmur1 APN 1 86386471 missense probably damaging 0.99
IGL00494:Nmur1 APN 1 86386362 missense probably benign
IGL01420:Nmur1 APN 1 86387391 missense probably benign 0.01
IGL02505:Nmur1 APN 1 86386335 missense probably benign 0.00
R0391:Nmur1 UTSW 1 86387678 missense probably damaging 0.99
R4213:Nmur1 UTSW 1 86387784 missense probably damaging 1.00
R4432:Nmur1 UTSW 1 86387565 missense probably damaging 1.00
R4583:Nmur1 UTSW 1 86386645 missense possibly damaging 0.90
R4718:Nmur1 UTSW 1 86387741 missense probably damaging 0.99
R6027:Nmur1 UTSW 1 86387331 nonsense probably null
R7025:Nmur1 UTSW 1 86387848 missense possibly damaging 0.94
R7097:Nmur1 UTSW 1 86387508 missense probably damaging 1.00
R7173:Nmur1 UTSW 1 86386468 missense probably benign 0.00
R7436:Nmur1 UTSW 1 86386378 missense probably benign 0.04
R7601:Nmur1 UTSW 1 86388019 missense probably damaging 1.00
R8920:Nmur1 UTSW 1 86387855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGACATGAGGCTGTAGAGCACC -3'
(R):5'- TCCAGTCTGGGGAAGGAATTGAGC -3'

Sequencing Primer
(F):5'- CTGTAGAGCACCGGGTTG -3'
(R):5'- gagcactgaccactctcc -3'
Posted On2014-01-29