Mutagenetix > Incidental Mutation

Incidental Mutation 'R1235:Plcb4'

152400

Institutional Source

Beutler Lab

Gene Symbol

Plcb4

Ensembl Gene

ENSMUSG00000039943

Gene Name

phospholipase C, beta 4

Synonyms

A930039J07Rik, C230058B11Rik

MMRRC Submission

039303-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1235 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135500931-135856513 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135814868 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 719 (G719R)

Ref Sequence

ENSEMBL: ENSMUSP00000139274 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000134310] [ENSMUST00000184371]

AlphaFold

Q91UZ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000035646
AA Change: G719R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: G719R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	1.1e-26	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	909	955	4.3e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110109
AA Change: G719R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: G719R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	6.1e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	913	955	1.2e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000134310
AA Change: G731R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117638
Gene: ENSMUSG00000039943
AA Change: G731R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	2.5e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	577	693	2.9e-75	SMART
C2	714	813	1.6e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184371
AA Change: G719R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943
AA Change: G719R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	9e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	909	955	4.1e-23	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arsg	T	C	11: 109,424,933 (GRCm39)		probably null	Het
Col6a1	C	A	10: 76,548,158 (GRCm39)	A633S	unknown	Het
Dnajb3	C	T	1: 88,133,201 (GRCm39)	R67H	probably benign	Het
Fam53c	T	A	18: 34,901,311 (GRCm39)	L76Q	probably damaging	Het
Gys2	A	T	6: 142,376,019 (GRCm39)	Y548N	probably damaging	Het
Kcnh3	T	A	15: 99,139,984 (GRCm39)		probably null	Het
Lrp2	C	T	2: 69,354,380 (GRCm39)	V483I	probably damaging	Het
Myom3	A	T	4: 135,516,854 (GRCm39)	Y808F	probably benign	Het
Nmur1	C	T	1: 86,314,415 (GRCm39)	G307S	probably damaging	Het
Or8w1	T	G	2: 87,465,159 (GRCm39)		probably null	Het
Pcdhb13	T	C	18: 37,578,012 (GRCm39)	*797Q	probably null	Het
Pld1	A	T	3: 28,082,883 (GRCm39)	T143S	probably benign	Het
Rem1	G	A	2: 152,476,455 (GRCm39)	V238M	probably damaging	Het
Sema5a	A	T	15: 32,609,372 (GRCm39)	Y426F	probably benign	Het
Trpc7	G	T	13: 57,035,352 (GRCm39)	H194N	probably damaging	Het
Vmn2r106	A	T	17: 20,499,741 (GRCm39)	F165I	probably benign	Het
Zdbf2	A	G	1: 63,348,232 (GRCm39)	T2204A	possibly damaging	Het
Zp2	A	T	7: 119,737,566 (GRCm39)	F240I	possibly damaging	Het

Other mutations in Plcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Plcb4	APN	2	135,813,718 (GRCm39)	missense	probably benign	0.26
IGL01405:Plcb4	APN	2	135,792,267 (GRCm39)	missense	probably damaging	1.00
IGL01522:Plcb4	APN	2	135,844,547 (GRCm39)	missense	probably damaging	1.00
IGL01589:Plcb4	APN	2	135,809,038 (GRCm39)	missense	probably benign
IGL02090:Plcb4	APN	2	135,789,041 (GRCm39)	missense	probably benign	0.00
IGL02247:Plcb4	APN	2	135,836,245 (GRCm39)	missense	possibly damaging	0.95
IGL02259:Plcb4	APN	2	135,752,166 (GRCm39)	critical splice donor site	probably null
IGL02338:Plcb4	APN	2	135,842,100 (GRCm39)	missense	possibly damaging	0.87
IGL02625:Plcb4	APN	2	135,803,714 (GRCm39)	missense	probably benign	0.19
IGL03026:Plcb4	APN	2	135,792,349 (GRCm39)	splice site	probably benign
IGL03111:Plcb4	APN	2	135,818,202 (GRCm39)	missense	probably damaging	1.00
R0044:Plcb4	UTSW	2	135,813,776 (GRCm39)	missense	probably damaging	1.00
R0066:Plcb4	UTSW	2	135,803,689 (GRCm39)	missense	probably benign	0.10
R0066:Plcb4	UTSW	2	135,803,689 (GRCm39)	missense	probably benign	0.10
R0143:Plcb4	UTSW	2	135,818,131 (GRCm39)	missense	probably damaging	1.00
R0234:Plcb4	UTSW	2	135,823,995 (GRCm39)	missense	probably benign	0.00
R0234:Plcb4	UTSW	2	135,823,995 (GRCm39)	missense	probably benign	0.00
R0348:Plcb4	UTSW	2	135,810,339 (GRCm39)	missense	probably damaging	1.00
R0557:Plcb4	UTSW	2	135,796,269 (GRCm39)	missense	probably damaging	0.99
R0591:Plcb4	UTSW	2	135,796,932 (GRCm39)	splice site	probably benign
R0975:Plcb4	UTSW	2	135,829,832 (GRCm39)	splice site	probably benign
R1187:Plcb4	UTSW	2	135,810,314 (GRCm39)	missense	probably benign	0.36
R1445:Plcb4	UTSW	2	135,842,109 (GRCm39)	missense	possibly damaging	0.90
R1562:Plcb4	UTSW	2	135,812,367 (GRCm39)	critical splice donor site	probably null
R1594:Plcb4	UTSW	2	135,812,310 (GRCm39)	splice site	probably benign
R1920:Plcb4	UTSW	2	135,854,947 (GRCm39)	missense	probably damaging	1.00
R2041:Plcb4	UTSW	2	135,780,191 (GRCm39)	missense	probably damaging	1.00
R2141:Plcb4	UTSW	2	135,818,019 (GRCm39)	missense	probably damaging	1.00
R2142:Plcb4	UTSW	2	135,818,019 (GRCm39)	missense	probably damaging	1.00
R2202:Plcb4	UTSW	2	135,844,514 (GRCm39)	missense	probably benign	0.01
R2203:Plcb4	UTSW	2	135,844,514 (GRCm39)	missense	probably benign	0.01
R2204:Plcb4	UTSW	2	135,844,514 (GRCm39)	missense	probably benign	0.01
R2250:Plcb4	UTSW	2	135,813,781 (GRCm39)	critical splice donor site	probably null
R2291:Plcb4	UTSW	2	135,781,903 (GRCm39)	missense	probably benign	0.08
R2326:Plcb4	UTSW	2	135,781,893 (GRCm39)	missense	probably damaging	0.99
R2442:Plcb4	UTSW	2	135,792,302 (GRCm39)	missense	probably damaging	1.00
R2939:Plcb4	UTSW	2	135,781,123 (GRCm39)	splice site	probably benign
R3774:Plcb4	UTSW	2	135,800,065 (GRCm39)	missense	probably benign	0.00
R3875:Plcb4	UTSW	2	135,844,552 (GRCm39)	missense	probably damaging	0.99
R4594:Plcb4	UTSW	2	135,844,519 (GRCm39)	missense	probably damaging	0.98
R4673:Plcb4	UTSW	2	135,774,191 (GRCm39)	missense	possibly damaging	0.68
R4812:Plcb4	UTSW	2	135,849,801 (GRCm39)	missense	probably damaging	1.00
R5084:Plcb4	UTSW	2	135,844,571 (GRCm39)	missense	probably damaging	1.00
R5468:Plcb4	UTSW	2	135,809,072 (GRCm39)	missense	probably damaging	1.00
R5498:Plcb4	UTSW	2	135,818,092 (GRCm39)	missense	probably damaging	1.00
R5923:Plcb4	UTSW	2	135,803,734 (GRCm39)	nonsense	probably null
R6241:Plcb4	UTSW	2	135,752,094 (GRCm39)	missense	possibly damaging	0.80
R6492:Plcb4	UTSW	2	135,814,991 (GRCm39)	nonsense	probably null
R6514:Plcb4	UTSW	2	135,796,916 (GRCm39)	missense	probably benign	0.22
R6570:Plcb4	UTSW	2	135,824,906 (GRCm39)	missense	probably benign	0.13
R6721:Plcb4	UTSW	2	135,752,157 (GRCm39)	missense	probably benign	0.01
R6915:Plcb4	UTSW	2	135,789,035 (GRCm39)	missense	possibly damaging	0.84
R6991:Plcb4	UTSW	2	135,752,114 (GRCm39)	missense	probably damaging	1.00
R7040:Plcb4	UTSW	2	135,774,182 (GRCm39)	missense	probably benign
R7086:Plcb4	UTSW	2	135,849,767 (GRCm39)	missense	probably benign
R7114:Plcb4	UTSW	2	135,824,043 (GRCm39)	critical splice donor site	probably null
R7249:Plcb4	UTSW	2	135,849,741 (GRCm39)	critical splice acceptor site	probably null
R7264:Plcb4	UTSW	2	135,807,000 (GRCm39)	missense	probably benign
R7361:Plcb4	UTSW	2	135,818,068 (GRCm39)	missense	possibly damaging	0.82
R7426:Plcb4	UTSW	2	135,842,139 (GRCm39)	missense	probably benign	0.00
R7429:Plcb4	UTSW	2	135,810,242 (GRCm39)	missense	probably damaging	1.00
R7430:Plcb4	UTSW	2	135,810,242 (GRCm39)	missense	probably damaging	1.00
R8010:Plcb4	UTSW	2	135,749,480 (GRCm39)	missense	probably benign	0.00
R8141:Plcb4	UTSW	2	135,781,169 (GRCm39)	missense	probably damaging	1.00
R9072:Plcb4	UTSW	2	135,849,795 (GRCm39)	missense	possibly damaging	0.93
R9119:Plcb4	UTSW	2	135,809,872 (GRCm39)	missense	probably damaging	1.00
R9287:Plcb4	UTSW	2	135,829,817 (GRCm39)	missense	probably benign	0.00
R9448:Plcb4	UTSW	2	135,752,045 (GRCm39)	missense	possibly damaging	0.47
R9578:Plcb4	UTSW	2	135,829,444 (GRCm39)	missense	probably benign	0.00
Z1177:Plcb4	UTSW	2	135,800,658 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTCAGGACATAGCCCATAGCCG -3'
(R):5'- ACCGAGGTCACTTAGTAGACGAAGG -3'

Sequencing Primer
(F):5'- TCCAGCCGTATTCAGAGGAG -3'
(R):5'- GGCTTCATGTAGAAAATGAGTCTTCC -3'

Posted On

2014-01-29