Incidental Mutation 'R1235:Rem1'
ID152401
Institutional Source Beutler Lab
Gene Symbol Rem1
Ensembl Gene ENSMUSG00000000359
Gene Namerad and gem related GTP binding protein 1
SynonymsE030011C07Rik
MMRRC Submission 039303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1235 (G1)
Quality Score102
Status Not validated
Chromosome2
Chromosomal Location152626951-152635198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152634535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 238 (V238M)
Ref Sequence ENSEMBL: ENSMUSP00000000369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000369]
Predicted Effect probably damaging
Transcript: ENSMUST00000000369
AA Change: V238M

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000369
Gene: ENSMUSG00000000359
AA Change: V238M

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:Roc 82 198 1e-10 PFAM
Pfam:Ras 82 244 2.6e-32 PFAM
low complexity region 258 290 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139370
Meta Mutation Damage Score 0.2146 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase and member of the RAS-like GTP-binding protein family. The encoded protein is expressed in endothelial cells, where it promotes reorganization of the actin cytoskeleton and morphological changes in the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsg T C 11: 109,534,107 probably null Het
Col6a1 C A 10: 76,712,324 A633S unknown Het
Dnajb3 C T 1: 88,205,479 R67H probably benign Het
Fam53c T A 18: 34,768,258 L76Q probably damaging Het
Gys2 A T 6: 142,430,293 Y548N probably damaging Het
Kcnh3 T A 15: 99,242,103 probably null Het
Lrp2 C T 2: 69,524,036 V483I probably damaging Het
Myom3 A T 4: 135,789,543 Y808F probably benign Het
Nmur1 C T 1: 86,386,693 G307S probably damaging Het
Olfr1132 T G 2: 87,634,815 probably null Het
Pcdhb13 T C 18: 37,444,959 *797Q probably null Het
Plcb4 G A 2: 135,972,948 G719R probably damaging Het
Pld1 A T 3: 28,028,734 T143S probably benign Het
Sema5a A T 15: 32,609,226 Y426F probably benign Het
Trpc7 G T 13: 56,887,539 H194N probably damaging Het
Vmn2r106 A T 17: 20,279,479 F165I probably benign Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zp2 A T 7: 120,138,343 F240I possibly damaging Het
Other mutations in Rem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1121:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1122:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1126:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1233:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1378:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1709:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1713:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1911:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1912:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R5442:Rem1 UTSW 2 152628057 critical splice acceptor site probably null
R5853:Rem1 UTSW 2 152628280 missense possibly damaging 0.92
R6062:Rem1 UTSW 2 152628097 start codon destroyed probably null 1.00
R6072:Rem1 UTSW 2 152634517 missense probably benign
R7215:Rem1 UTSW 2 152628149 missense probably damaging 1.00
R7635:Rem1 UTSW 2 152634665 missense probably damaging 1.00
X0057:Rem1 UTSW 2 152629191 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCTTCCTGAGAGTTTGAACACA -3'
(R):5'- CTTTTCTCCTCAGTGGCACCATA -3'

Sequencing Primer
(F):5'- CATCTCTTCCCACCTTTATC -3'
(R):5'- ATAGTGTCCCATCACCCCAG -3'
Posted On2014-01-29