Incidental Mutation 'R1235:Arsg'
ID152407
Institutional Source Beutler Lab
Gene Symbol Arsg
Ensembl Gene ENSMUSG00000020604
Gene Namearylsulfatase G
Synonyms6330406P08Rik
MMRRC Submission 039303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1235 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location109473374-109573330 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 109534107 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020928] [ENSMUST00000020928] [ENSMUST00000106697] [ENSMUST00000106697]
Predicted Effect probably null
Transcript: ENSMUST00000020928
SMART Domains Protein: ENSMUSP00000020928
Gene: ENSMUSG00000020604

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 2.9e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020928
SMART Domains Protein: ENSMUSP00000020928
Gene: ENSMUSG00000020604

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 2.9e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106697
SMART Domains Protein: ENSMUSP00000102308
Gene: ENSMUSG00000020604

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 4.7e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106697
SMART Domains Protein: ENSMUSP00000102308
Gene: ENSMUSG00000020604

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 4.7e-25 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null mutation display lysosomal storage pathology in the nervous system and peripheral tissues, including the liver and kidneys, resulting in Purkinje cell loss and age dependent cognitive impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Col6a1 C A 10: 76,712,324 A633S unknown Het
Dnajb3 C T 1: 88,205,479 R67H probably benign Het
Fam53c T A 18: 34,768,258 L76Q probably damaging Het
Gys2 A T 6: 142,430,293 Y548N probably damaging Het
Kcnh3 T A 15: 99,242,103 probably null Het
Lrp2 C T 2: 69,524,036 V483I probably damaging Het
Myom3 A T 4: 135,789,543 Y808F probably benign Het
Nmur1 C T 1: 86,386,693 G307S probably damaging Het
Olfr1132 T G 2: 87,634,815 probably null Het
Pcdhb13 T C 18: 37,444,959 *797Q probably null Het
Plcb4 G A 2: 135,972,948 G719R probably damaging Het
Pld1 A T 3: 28,028,734 T143S probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sema5a A T 15: 32,609,226 Y426F probably benign Het
Trpc7 G T 13: 56,887,539 H194N probably damaging Het
Vmn2r106 A T 17: 20,279,479 F165I probably benign Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zp2 A T 7: 120,138,343 F240I possibly damaging Het
Other mutations in Arsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Arsg APN 11 109525446 missense possibly damaging 0.88
IGL02257:Arsg APN 11 109521647 splice site probably benign
IGL03069:Arsg APN 11 109563256 missense probably damaging 1.00
R0421:Arsg UTSW 11 109527766 missense probably damaging 1.00
R1830:Arsg UTSW 11 109563274 critical splice donor site probably null
R2831:Arsg UTSW 11 109525449 missense possibly damaging 0.61
R4573:Arsg UTSW 11 109517282 missense probably damaging 1.00
R4780:Arsg UTSW 11 109534013 missense possibly damaging 0.80
R4811:Arsg UTSW 11 109534072 missense probably benign 0.00
R5510:Arsg UTSW 11 109527874 missense probably benign 0.33
R5861:Arsg UTSW 11 109563188 missense probably damaging 1.00
R5944:Arsg UTSW 11 109535311 missense probably damaging 0.99
R6502:Arsg UTSW 11 109517336 missense probably damaging 1.00
R6962:Arsg UTSW 11 109521669 missense probably damaging 1.00
X0019:Arsg UTSW 11 109563253 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATTCCAGCACCAGTGGAAGACCC -3'
(R):5'- TTCTTGTGACCGGATCTTGCAGAAC -3'

Sequencing Primer
(F):5'- CAGTGGAAGACCCTTCCTG -3'
(R):5'- GGATCTTGCAGAACCCAACAG -3'
Posted On2014-01-29