Incidental Mutation 'R1235:Fam53c'
ID152413
Institutional Source Beutler Lab
Gene Symbol Fam53c
Ensembl Gene ENSMUSG00000034300
Gene Namefamily with sequence similarity 53, member C
Synonyms
MMRRC Submission 039303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1235 (G1)
Quality Score115
Status Not validated
Chromosome18
Chromosomal Location34758906-34773760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34768258 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 76 (L76Q)
Ref Sequence ENSEMBL: ENSMUSP00000095226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049281] [ENSMUST00000097622]
Predicted Effect probably damaging
Transcript: ENSMUST00000049281
AA Change: L76Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037034
Gene: ENSMUSG00000034300
AA Change: L76Q

DomainStartEndE-ValueType
Pfam:FAM53 1 307 3.9e-87 PFAM
low complexity region 334 346 N/A INTRINSIC
low complexity region 348 370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097622
AA Change: L76Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095226
Gene: ENSMUSG00000034300
AA Change: L76Q

DomainStartEndE-ValueType
Pfam:FAM53 1 307 1.9e-87 PFAM
low complexity region 334 346 N/A INTRINSIC
low complexity region 348 370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsg T C 11: 109,534,107 probably null Het
Col6a1 C A 10: 76,712,324 A633S unknown Het
Dnajb3 C T 1: 88,205,479 R67H probably benign Het
Gys2 A T 6: 142,430,293 Y548N probably damaging Het
Kcnh3 T A 15: 99,242,103 probably null Het
Lrp2 C T 2: 69,524,036 V483I probably damaging Het
Myom3 A T 4: 135,789,543 Y808F probably benign Het
Nmur1 C T 1: 86,386,693 G307S probably damaging Het
Olfr1132 T G 2: 87,634,815 probably null Het
Pcdhb13 T C 18: 37,444,959 *797Q probably null Het
Plcb4 G A 2: 135,972,948 G719R probably damaging Het
Pld1 A T 3: 28,028,734 T143S probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sema5a A T 15: 32,609,226 Y426F probably benign Het
Trpc7 G T 13: 56,887,539 H194N probably damaging Het
Vmn2r106 A T 17: 20,279,479 F165I probably benign Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zp2 A T 7: 120,138,343 F240I possibly damaging Het
Other mutations in Fam53c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02720:Fam53c APN 18 34770667 missense probably damaging 1.00
beebee UTSW 18 34762470 splice site probably null
R3689:Fam53c UTSW 18 34770833 missense probably damaging 1.00
R4691:Fam53c UTSW 18 34768690 missense probably damaging 1.00
R4692:Fam53c UTSW 18 34768690 missense probably damaging 1.00
R5278:Fam53c UTSW 18 34762618 start gained probably benign
R6118:Fam53c UTSW 18 34768690 missense probably damaging 1.00
R7110:Fam53c UTSW 18 34762470 splice site probably null
R8445:Fam53c UTSW 18 34768315 missense probably benign 0.00
R8500:Fam53c UTSW 18 34768801 missense probably damaging 1.00
R8962:Fam53c UTSW 18 34768176 missense probably damaging 1.00
Z1177:Fam53c UTSW 18 34770850 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGGAAGGTTAGGTTGTCCGTAGA -3'
(R):5'- TCCACAGGCACCGAGAGTGA -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- AGCGGCAGTGCCTCTTG -3'
Posted On2014-01-29