Mutagenetix > Incidental Mutation

Incidental Mutation 'R1236:Aqr'

152419

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1236 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113931642-114005788 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 113947136 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1015 (F1015L)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: F1015L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: F1015L

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102543
AA Change: F1015L

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: F1015L

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140441

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,685,756 (GRCm39)	Y360C	probably damaging	Het
Afap1l2	T	A	19: 56,904,904 (GRCm39)	H566L	possibly damaging	Het
Cep112	T	A	11: 108,750,200 (GRCm39)	L901H	probably damaging	Het
Col26a1	A	G	5: 136,783,780 (GRCm39)	V229A	probably benign	Het
Cyp4a14	T	C	4: 115,349,367 (GRCm39)	N231S	probably benign	Het
Dmac2l	T	C	12: 69,788,592 (GRCm39)		probably null	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,504,945 (GRCm39)		probably null	Het
Gm37240	T	A	3: 84,435,003 (GRCm39)	N13I	probably benign	Het
Kbtbd7	G	T	14: 79,665,272 (GRCm39)	C368F	probably benign	Het
Kyat3	A	G	3: 142,444,020 (GRCm39)	D418G	probably benign	Het
Lpcat2	A	G	8: 93,613,197 (GRCm39)	M246V	probably damaging	Het
Nbas	T	A	12: 13,319,242 (GRCm39)	W31R	probably damaging	Het
Nckap1	C	T	2: 80,348,286 (GRCm39)	S889N	probably benign	Het
Npepl1	T	A	2: 173,956,273 (GRCm39)		probably null	Het
Or6c212	A	G	10: 129,558,675 (GRCm39)	V246A	probably damaging	Het
Or8b1	T	C	9: 38,399,525 (GRCm39)	S67P	probably damaging	Het
P4ha3	T	C	7: 99,943,056 (GRCm39)	L147P	probably damaging	Het
Pkp2	C	A	16: 16,043,766 (GRCm39)	H173Q	probably benign	Het
Prlr	C	A	15: 10,325,367 (GRCm39)	T180K	probably benign	Het
Psph	A	G	5: 129,848,540 (GRCm39)	M47T	probably damaging	Het
Rufy2	A	G	10: 62,830,549 (GRCm39)	N217S	probably benign	Het
Sgcg	T	C	14: 61,483,219 (GRCm39)	M61V	probably damaging	Het
Snrnp40	C	G	4: 130,271,836 (GRCm39)		probably null	Het
Spint1	A	G	2: 119,076,054 (GRCm39)	T217A	probably benign	Het
Tert	T	C	13: 73,784,498 (GRCm39)	L648P	probably damaging	Het
Vwde	A	T	6: 13,187,152 (GRCm39)	Y778*	probably null	Het
Zeb2	T	A	2: 44,884,658 (GRCm39)	D967V	probably damaging	Het
Zfp687	T	C	3: 94,919,355 (GRCm39)	N139S	probably benign	Het
Zscan26	T	C	13: 21,629,940 (GRCm39)	M188V	probably benign	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	113,956,423 (GRCm39)	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	113,982,006 (GRCm39)	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	113,950,508 (GRCm39)	nonsense	probably null
IGL02297:Aqr	APN	2	113,980,962 (GRCm39)	missense	probably benign	0.24
IGL02380:Aqr	APN	2	113,940,417 (GRCm39)	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	113,967,398 (GRCm39)	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	113,949,261 (GRCm39)	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	113,943,127 (GRCm39)	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	113,943,835 (GRCm39)	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	113,965,305 (GRCm39)	splice site	probably benign
IGL03001:Aqr	APN	2	113,977,400 (GRCm39)	missense	probably benign
IGL03092:Aqr	APN	2	113,989,424 (GRCm39)	missense	probably benign	0.38
IGL03222:Aqr	APN	2	113,951,737 (GRCm39)	missense	probably damaging	1.00
capricorn	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
Goat	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
Pliades	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
sagittarius	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
Zodiac	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	113,961,215 (GRCm39)	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	113,989,491 (GRCm39)	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114,000,533 (GRCm39)	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	113,988,085 (GRCm39)	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	113,961,092 (GRCm39)	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	113,961,085 (GRCm39)	missense	probably benign	0.00
R0685:Aqr	UTSW	2	113,971,458 (GRCm39)	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	113,980,890 (GRCm39)	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	113,992,133 (GRCm39)	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	113,967,485 (GRCm39)	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	113,961,015 (GRCm39)	critical splice donor site	probably null
R2377:Aqr	UTSW	2	113,971,421 (GRCm39)	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	113,967,398 (GRCm39)	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R3715:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R4586:Aqr	UTSW	2	113,943,058 (GRCm39)	missense	probably benign	0.06
R4663:Aqr	UTSW	2	113,992,147 (GRCm39)	nonsense	probably null
R4809:Aqr	UTSW	2	114,005,695 (GRCm39)	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	113,940,418 (GRCm39)	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	113,943,832 (GRCm39)	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114,000,506 (GRCm39)	critical splice donor site	probably null
R5050:Aqr	UTSW	2	113,943,090 (GRCm39)	nonsense	probably null
R5213:Aqr	UTSW	2	113,943,808 (GRCm39)	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	113,947,059 (GRCm39)	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	113,979,515 (GRCm39)	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	113,986,746 (GRCm39)	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	113,957,442 (GRCm39)	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	113,973,530 (GRCm39)	nonsense	probably null
R6015:Aqr	UTSW	2	114,005,646 (GRCm39)	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	113,986,758 (GRCm39)	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	113,940,445 (GRCm39)	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	113,979,477 (GRCm39)	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	113,947,052 (GRCm39)	nonsense	probably null
R7211:Aqr	UTSW	2	113,965,204 (GRCm39)	missense	probably benign	0.01
R7232:Aqr	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	113,934,543 (GRCm39)	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	113,950,427 (GRCm39)	nonsense	probably null
R7490:Aqr	UTSW	2	113,989,349 (GRCm39)	critical splice donor site	probably null
R7526:Aqr	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	113,945,074 (GRCm39)	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	113,992,161 (GRCm39)	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	113,943,806 (GRCm39)	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	113,949,358 (GRCm39)	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	113,967,474 (GRCm39)	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	113,934,528 (GRCm39)	missense	probably benign	0.04
R9527:Aqr	UTSW	2	113,932,037 (GRCm39)	missense	probably benign	0.02
R9664:Aqr	UTSW	2	113,971,396 (GRCm39)	nonsense	probably null
Z1176:Aqr	UTSW	2	113,940,472 (GRCm39)	missense	probably benign	0.25
Z1176:Aqr	UTSW	2	113,938,603 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATGACGGTCTGGTAAGACAATCAAGTG -3'
(R):5'- cttacggggactttgaataatgcaGCTA -3'

Sequencing Primer
(F):5'- GAGACCTTTCATAAGAAGTGAACC -3'
(R):5'- ggactttgaataatgcaGCTATATTG -3'

Posted On

2014-01-29