Mutagenetix > Incidental Mutation

Incidental Mutation 'R1236:Npepl1'

152421

Institutional Source

Beutler Lab

Gene Symbol

Npepl1

Ensembl Gene

ENSMUSG00000039263

Gene Name

aminopeptidase-like 1

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R1236 (G1)

Quality Score

168

Status

Not validated

Chromosome

Chromosomal Location

174110349-174123070 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 174114480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000042808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044415]

AlphaFold

Q6NSR8

Predicted Effect

probably null
Transcript: ENSMUST00000044415

SMART Domains

Protein: ENSMUSP00000042808
Gene: ENSMUSG00000039263

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
Pfam:Peptidase_M17	179	484	1.9e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125502

SMART Domains

Protein: ENSMUSP00000133202
Gene: ENSMUSG00000039263

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M17	104	207	4.4e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153957

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,795,744	Y360C	probably damaging	Het
Afap1l2	T	A	19: 56,916,472	H566L	possibly damaging	Het
Aqr	G	T	2: 114,116,655	F1015L	probably damaging	Het
Atp5s	T	C	12: 69,741,818		probably null	Het
Cep112	T	A	11: 108,859,374	L901H	probably damaging	Het
Col26a1	A	G	5: 136,754,926	V229A	probably benign	Het
Cyp4a14	T	C	4: 115,492,170	N231S	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gm37240	T	A	3: 84,527,696	N13I	probably benign	Het
Kbtbd7	G	T	14: 79,427,832	C368F	probably benign	Het
Kyat3	A	G	3: 142,738,259	D418G	probably benign	Het
Lpcat2	A	G	8: 92,886,569	M246V	probably damaging	Het
Nbas	T	A	12: 13,269,241	W31R	probably damaging	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Olfr805	A	G	10: 129,722,806	V246A	probably damaging	Het
Olfr906	T	C	9: 38,488,229	S67P	probably damaging	Het
P4ha3	T	C	7: 100,293,849	L147P	probably damaging	Het
Pkp2	C	A	16: 16,225,902	H173Q	probably benign	Het
Prlr	C	A	15: 10,325,281	T180K	probably benign	Het
Psph	A	G	5: 129,771,476	M47T	probably damaging	Het
Rufy2	A	G	10: 62,994,770	N217S	probably benign	Het
Sgcg	T	C	14: 61,245,770	M61V	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spint1	A	G	2: 119,245,573	T217A	probably benign	Het
Tert	T	C	13: 73,636,379	L648P	probably damaging	Het
Vwde	A	T	6: 13,187,153	Y778*	probably null	Het
Zeb2	T	A	2: 44,994,646	D967V	probably damaging	Het
Zfp687	T	C	3: 95,012,044	N139S	probably benign	Het
Zscan26	T	C	13: 21,445,770	M188V	probably benign	Het

Other mutations in Npepl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Npepl1	APN	2	174120548	missense	probably damaging	1.00
IGL01651:Npepl1	APN	2	174114388	splice site	probably benign
IGL01998:Npepl1	APN	2	174116200	splice site	probably benign
IGL02079:Npepl1	APN	2	174119390	intron	probably benign
R0081:Npepl1	UTSW	2	174116086	missense	probably damaging	1.00
R2350:Npepl1	UTSW	2	174111773	missense	probably benign
R3780:Npepl1	UTSW	2	174120654	missense	probably damaging	1.00
R3950:Npepl1	UTSW	2	174121113	missense	probably damaging	1.00
R4688:Npepl1	UTSW	2	174114442	missense	possibly damaging	0.78
R5650:Npepl1	UTSW	2	174121536	missense	possibly damaging	0.83
R5916:Npepl1	UTSW	2	174121544	missense	probably benign	0.01
R6007:Npepl1	UTSW	2	174121057	missense	probably benign	0.03
R6487:Npepl1	UTSW	2	174111732	missense	probably benign	0.16
R7267:Npepl1	UTSW	2	174122116	missense	probably damaging	1.00
R7881:Npepl1	UTSW	2	174120594	missense	probably damaging	1.00
R8103:Npepl1	UTSW	2	174111209	missense	probably benign	0.00
R9547:Npepl1	UTSW	2	174120237	missense	probably null	0.88
R9740:Npepl1	UTSW	2	174121490	missense	probably damaging	0.99
Z1177:Npepl1	UTSW	2	174122130	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTAGTTCCTTTCCCACCATGAAGC -3'
(R):5'- GGCCATGAACATGTGCAATCGAG -3'

Sequencing Primer
(F):5'- CATGGATAGACTCATCTTTGGCG -3'
(R):5'- CTAGGGATGCTCTGTCTCCTAAG -3'

Posted On

2014-01-29