Incidental Mutation 'R1236:Npepl1'
ID152421
Institutional Source Beutler Lab
Gene Symbol Npepl1
Ensembl Gene ENSMUSG00000039263
Gene Nameaminopeptidase-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1236 (G1)
Quality Score168
Status Not validated
Chromosome2
Chromosomal Location174110349-174123070 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 174114480 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044415]
Predicted Effect probably null
Transcript: ENSMUST00000044415
SMART Domains Protein: ENSMUSP00000042808
Gene: ENSMUSG00000039263

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Pfam:Peptidase_M17 179 484 1.9e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125502
SMART Domains Protein: ENSMUSP00000133202
Gene: ENSMUSG00000039263

DomainStartEndE-ValueType
Pfam:Peptidase_M17 104 207 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153957
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Npepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Npepl1 APN 2 174120548 missense probably damaging 1.00
IGL01651:Npepl1 APN 2 174114388 splice site probably benign
IGL01998:Npepl1 APN 2 174116200 splice site probably benign
IGL02079:Npepl1 APN 2 174119390 intron probably benign
R0081:Npepl1 UTSW 2 174116086 missense probably damaging 1.00
R2350:Npepl1 UTSW 2 174111773 missense probably benign
R3780:Npepl1 UTSW 2 174120654 missense probably damaging 1.00
R3950:Npepl1 UTSW 2 174121113 missense probably damaging 1.00
R4688:Npepl1 UTSW 2 174114442 missense possibly damaging 0.78
R5650:Npepl1 UTSW 2 174121536 missense possibly damaging 0.83
R5916:Npepl1 UTSW 2 174121544 missense probably benign 0.01
R6007:Npepl1 UTSW 2 174121057 missense probably benign 0.03
R6487:Npepl1 UTSW 2 174111732 missense probably benign 0.16
R7267:Npepl1 UTSW 2 174122116 missense probably damaging 1.00
R7881:Npepl1 UTSW 2 174120594 missense probably damaging 1.00
R8103:Npepl1 UTSW 2 174111209 missense probably benign 0.00
Z1177:Npepl1 UTSW 2 174122130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGTTCCTTTCCCACCATGAAGC -3'
(R):5'- GGCCATGAACATGTGCAATCGAG -3'

Sequencing Primer
(F):5'- CATGGATAGACTCATCTTTGGCG -3'
(R):5'- CTAGGGATGCTCTGTCTCCTAAG -3'
Posted On2014-01-29