Incidental Mutation 'R1236:Cyp4a14'
ID 152425
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1236 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115349367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 231 (N231S)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably benign
Transcript: ENSMUST00000030487
AA Change: N231S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: N231S

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,685,756 (GRCm39) Y360C probably damaging Het
Afap1l2 T A 19: 56,904,904 (GRCm39) H566L possibly damaging Het
Aqr G T 2: 113,947,136 (GRCm39) F1015L probably damaging Het
Cep112 T A 11: 108,750,200 (GRCm39) L901H probably damaging Het
Col26a1 A G 5: 136,783,780 (GRCm39) V229A probably benign Het
Dmac2l T C 12: 69,788,592 (GRCm39) probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gm37240 T A 3: 84,435,003 (GRCm39) N13I probably benign Het
Kbtbd7 G T 14: 79,665,272 (GRCm39) C368F probably benign Het
Kyat3 A G 3: 142,444,020 (GRCm39) D418G probably benign Het
Lpcat2 A G 8: 93,613,197 (GRCm39) M246V probably damaging Het
Nbas T A 12: 13,319,242 (GRCm39) W31R probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Npepl1 T A 2: 173,956,273 (GRCm39) probably null Het
Or6c212 A G 10: 129,558,675 (GRCm39) V246A probably damaging Het
Or8b1 T C 9: 38,399,525 (GRCm39) S67P probably damaging Het
P4ha3 T C 7: 99,943,056 (GRCm39) L147P probably damaging Het
Pkp2 C A 16: 16,043,766 (GRCm39) H173Q probably benign Het
Prlr C A 15: 10,325,367 (GRCm39) T180K probably benign Het
Psph A G 5: 129,848,540 (GRCm39) M47T probably damaging Het
Rufy2 A G 10: 62,830,549 (GRCm39) N217S probably benign Het
Sgcg T C 14: 61,483,219 (GRCm39) M61V probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spint1 A G 2: 119,076,054 (GRCm39) T217A probably benign Het
Tert T C 13: 73,784,498 (GRCm39) L648P probably damaging Het
Vwde A T 6: 13,187,152 (GRCm39) Y778* probably null Het
Zeb2 T A 2: 44,884,658 (GRCm39) D967V probably damaging Het
Zfp687 T C 3: 94,919,355 (GRCm39) N139S probably benign Het
Zscan26 T C 13: 21,629,940 (GRCm39) M188V probably benign Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCATGTCCTGTGGAACCCTAGATG -3'
(R):5'- ATGCCTTGGTATTGTGTGCCCC -3'

Sequencing Primer
(F):5'- CACAGAGCCATGTTTAAGGCTG -3'
(R):5'- ATGACTATAGAGGGCCCACTCT -3'
Posted On 2014-01-29