Incidental Mutation 'R1236:Psph'
ID152427
Institutional Source Beutler Lab
Gene Symbol Psph
Ensembl Gene ENSMUSG00000029446
Gene Namephosphoserine phosphatase
SynonymsPSPase
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1236 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129765558-129787449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129771476 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 47 (M47T)
Ref Sequence ENSEMBL: ENSMUSP00000144667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031399] [ENSMUST00000118268] [ENSMUST00000136507] [ENSMUST00000201394]
Predicted Effect probably benign
Transcript: ENSMUST00000031399
AA Change: M47T

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031399
Gene: ENSMUSG00000029446
AA Change: M47T

DomainStartEndE-ValueType
Pfam:Hydrolase 14 191 5.7e-19 PFAM
Pfam:HAD 17 187 4e-13 PFAM
Pfam:UMPH-1 62 192 5.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118268
AA Change: M47T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113671
Gene: ENSMUSG00000029446
AA Change: M47T

DomainStartEndE-ValueType
PDB:1L8O|B 1 94 1e-55 PDB
SCOP:d1j97a_ 15 92 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136280
Predicted Effect probably damaging
Transcript: ENSMUST00000136507
AA Change: M47T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116292
Gene: ENSMUSG00000029446
AA Change: M47T

DomainStartEndE-ValueType
PDB:1NNL|B 1 59 1e-32 PDB
SCOP:d1j97a_ 15 58 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201022
Predicted Effect probably damaging
Transcript: ENSMUST00000201394
AA Change: M47T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144667
Gene: ENSMUSG00000029446
AA Change: M47T

DomainStartEndE-ValueType
Pfam:Hydrolase 14 113 4.5e-6 PFAM
Meta Mutation Damage Score 0.5134 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a subfamily of the phosphotransferases. This encoded enzyme is responsible for the third and last step in L-serine formation. It catalyzes magnesium-dependent hydrolysis of L-phosphoserine and is also involved in an exchange reaction between L-serine and L-phosphoserine. Deficiency of this protein is thought to be linked to Williams syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Psph
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0121:Psph UTSW 5 129791570 unclassified probably benign
R0539:Psph UTSW 5 129766577 unclassified probably benign
R0650:Psph UTSW 5 129791570 unclassified probably benign
R1474:Psph UTSW 5 129771550 missense probably damaging 1.00
R1844:Psph UTSW 5 129766468 missense probably damaging 1.00
R2130:Psph UTSW 5 129787539 unclassified probably null
R3857:Psph UTSW 5 129771476 missense probably damaging 1.00
R4300:Psph UTSW 5 129787465 unclassified probably null
R4368:Psph UTSW 5 129771590 missense probably benign 0.00
R4738:Psph UTSW 5 129769386 critical splice acceptor site probably null
R5306:Psph UTSW 5 129769367 missense probably damaging 1.00
R5859:Psph UTSW 5 129790621 unclassified probably benign
R6269:Psph UTSW 5 129766465 missense probably damaging 0.99
R7552:Psph UTSW 5 129770736 missense probably benign 0.01
R7593:Psph UTSW 5 129787273 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCCAGGCTGCCTAAGAATGC -3'
(R):5'- AAACTTCCCAGGATGGTCTCCCAC -3'

Sequencing Primer
(F):5'- CAGAGACAAGCCTGTTTTGC -3'
(R):5'- TCCCACTCAGAGCTGAGGAAG -3'
Posted On2014-01-29