Incidental Mutation 'R1236:Col26a1'
ID152428
Institutional Source Beutler Lab
Gene Symbol Col26a1
Ensembl Gene ENSMUSG00000004415
Gene Namecollagen, type XXVI, alpha 1
SynonymsCol26a1, Collagen XXVI, Emu2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1236 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136741759-136883209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136754926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 229 (V229A)
Ref Sequence ENSEMBL: ENSMUSP00000106732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057497] [ENSMUST00000111103]
Predicted Effect probably benign
Transcript: ENSMUST00000057497
AA Change: V231A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052095
Gene: ENSMUSG00000004415
AA Change: V231A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:EMI 53 123 5.6e-21 PFAM
low complexity region 143 157 N/A INTRINSIC
Pfam:Collagen 189 252 2e-10 PFAM
Pfam:Collagen 217 273 8.4e-9 PFAM
low complexity region 302 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111103
AA Change: V229A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106732
Gene: ENSMUSG00000004415
AA Change: V229A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:EMI 52 123 1.2e-27 PFAM
low complexity region 141 155 N/A INTRINSIC
Pfam:Collagen 187 250 2.1e-10 PFAM
Pfam:Collagen 215 271 8.6e-9 PFAM
Pfam:Collagen 298 335 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156962
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an emilin domain and two collagen stretches. This gene may be associated with aspirin-intolerant asthma. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Col26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Col26a1 APN 5 136754339 nonsense probably null
IGL03028:Col26a1 APN 5 136743118 missense possibly damaging 0.78
IGL03144:Col26a1 APN 5 136765348 missense probably damaging 0.99
PIT4514001:Col26a1 UTSW 5 136751725 missense probably benign
R0454:Col26a1 UTSW 5 136754193 missense probably benign 0.01
R0833:Col26a1 UTSW 5 136765300 critical splice donor site probably null
R0836:Col26a1 UTSW 5 136765300 critical splice donor site probably null
R1187:Col26a1 UTSW 5 136744166 missense probably damaging 0.99
R4646:Col26a1 UTSW 5 136847550 missense probably damaging 1.00
R4804:Col26a1 UTSW 5 136836725 missense probably damaging 0.99
R5772:Col26a1 UTSW 5 136847566 nonsense probably null
R6026:Col26a1 UTSW 5 136847500 missense probably damaging 1.00
R6481:Col26a1 UTSW 5 136744178 missense probably benign 0.45
R6919:Col26a1 UTSW 5 136744234 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AACAAACCCTGGGCCTTAGCAG -3'
(R):5'- AGACAGGGAAAGGCAACTTCTCAAC -3'

Sequencing Primer
(F):5'- AGGGTCCCAGTAGACTCTTGTC -3'
(R):5'- agaatcccccagtgaggag -3'
Posted On2014-01-29