Mutagenetix > Incidental Mutation

Incidental Mutation 'R1236:P4ha3'

152430

Institutional Source

Beutler Lab

Gene Symbol

P4ha3

Ensembl Gene

ENSMUSG00000051048

Gene Name

procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R1236 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100285520-100319699 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100293849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 147 (L147P)

Ref Sequence

ENSEMBL: ENSMUSP00000055297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057023] [ENSMUST00000139790]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057023
AA Change: L147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048
AA Change: L147P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:P4Ha_N	31	159	1.4e-31	PFAM
SCOP:d1ihga1	177	258	8e-4	SMART
P4Hc	344	526	1.08e-50	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000138465
AA Change: L13P

SMART Domains

Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048
AA Change: L13P

Domain	Start	End	E-Value	Type
PDB:4BTB\|A	1	141	7e-17	PDB
SCOP:d1ihga1	44	125	4e-4	SMART
P4Hc	211	372	4.89e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139790

SMART Domains

Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	43	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148620

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,795,744	Y360C	probably damaging	Het
Afap1l2	T	A	19: 56,916,472	H566L	possibly damaging	Het
Aqr	G	T	2: 114,116,655	F1015L	probably damaging	Het
Atp5s	T	C	12: 69,741,818		probably null	Het
Cep112	T	A	11: 108,859,374	L901H	probably damaging	Het
Col26a1	A	G	5: 136,754,926	V229A	probably benign	Het
Cyp4a14	T	C	4: 115,492,170	N231S	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gm37240	T	A	3: 84,527,696	N13I	probably benign	Het
Kbtbd7	G	T	14: 79,427,832	C368F	probably benign	Het
Kyat3	A	G	3: 142,738,259	D418G	probably benign	Het
Lpcat2	A	G	8: 92,886,569	M246V	probably damaging	Het
Nbas	T	A	12: 13,269,241	W31R	probably damaging	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Npepl1	T	A	2: 174,114,480		probably null	Het
Olfr805	A	G	10: 129,722,806	V246A	probably damaging	Het
Olfr906	T	C	9: 38,488,229	S67P	probably damaging	Het
Pkp2	C	A	16: 16,225,902	H173Q	probably benign	Het
Prlr	C	A	15: 10,325,281	T180K	probably benign	Het
Psph	A	G	5: 129,771,476	M47T	probably damaging	Het
Rufy2	A	G	10: 62,994,770	N217S	probably benign	Het
Sgcg	T	C	14: 61,245,770	M61V	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spint1	A	G	2: 119,245,573	T217A	probably benign	Het
Tert	T	C	13: 73,636,379	L648P	probably damaging	Het
Vwde	A	T	6: 13,187,153	Y778*	probably null	Het
Zeb2	T	A	2: 44,994,646	D967V	probably damaging	Het
Zfp687	T	C	3: 95,012,044	N139S	probably benign	Het
Zscan26	T	C	13: 21,445,770	M188V	probably benign	Het

Other mutations in P4ha3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01347:P4ha3	APN	7	100305933	missense	probably damaging	1.00
IGL01875:P4ha3	APN	7	100300652	missense	probably damaging	0.97
IGL02265:P4ha3	APN	7	100293932	missense	probably benign
IGL02957:P4ha3	APN	7	100318905	splice site	probably benign
IGL03279:P4ha3	APN	7	100300686	missense	probably damaging	1.00
R0006:P4ha3	UTSW	7	100318948	nonsense	probably null
R0880:P4ha3	UTSW	7	100305909	missense	probably benign	0.06
R1066:P4ha3	UTSW	7	100318063	missense	possibly damaging	0.77
R1118:P4ha3	UTSW	7	100313328	missense	probably damaging	0.99
R1119:P4ha3	UTSW	7	100313328	missense	probably damaging	0.99
R1613:P4ha3	UTSW	7	100313250	missense	possibly damaging	0.95
R1778:P4ha3	UTSW	7	100300691	splice site	probably null
R2042:P4ha3	UTSW	7	100300690	critical splice donor site	probably null
R3437:P4ha3	UTSW	7	100285624	missense	possibly damaging	0.93
R4393:P4ha3	UTSW	7	100305607	missense	probably benign	0.06
R5411:P4ha3	UTSW	7	100293815	missense	probably damaging	1.00
R5722:P4ha3	UTSW	7	100305991	missense	probably benign	0.03
R6209:P4ha3	UTSW	7	100317085	missense	probably benign	0.09
R6462:P4ha3	UTSW	7	100314666	missense	probably damaging	1.00
R6606:P4ha3	UTSW	7	100305644	missense	probably damaging	0.99
R7578:P4ha3	UTSW	7	100293914	missense	probably benign	0.02
R7769:P4ha3	UTSW	7	100285717	missense	probably damaging	0.97
R8031:P4ha3	UTSW	7	100292698	missense	probably damaging	1.00
R8090:P4ha3	UTSW	7	100300652	missense	probably damaging	0.97
R8296:P4ha3	UTSW	7	100317102	missense	probably damaging	1.00
R8379:P4ha3	UTSW	7	100293779	missense	probably damaging	0.99
R8501:P4ha3	UTSW	7	100313355	missense	probably damaging	1.00
R8516:P4ha3	UTSW	7	100314662	missense	probably damaging	0.97
R8692:P4ha3	UTSW	7	100306021	missense	probably damaging	0.99
RF033:P4ha3	UTSW	7	100310810	frame shift	probably null
Z1177:P4ha3	UTSW	7	100293788	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CATGAGTGAAATGCCCATTGCCTG -3'
(R):5'- TCCCTATGGCAAGAGCATGGGAAG -3'

Sequencing Primer
(F):5'- AAATGCCCATTGCCTGTGTTTG -3'
(R):5'- GCAATGCAGTCTTAGTGATCTACC -3'

Posted On

2014-01-29