Incidental Mutation 'R1236:P4ha3'
ID152430
Institutional Source Beutler Lab
Gene Symbol P4ha3
Ensembl Gene ENSMUSG00000051048
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1236 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100285520-100319699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100293849 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 147 (L147P)
Ref Sequence ENSEMBL: ENSMUSP00000055297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057023] [ENSMUST00000139790]
Predicted Effect probably damaging
Transcript: ENSMUST00000057023
AA Change: L147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048
AA Change: L147P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:P4Ha_N 31 159 1.4e-31 PFAM
SCOP:d1ihga1 177 258 8e-4 SMART
P4Hc 344 526 1.08e-50 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138465
AA Change: L13P
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048
AA Change: L13P

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139790
SMART Domains Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148620
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in P4ha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:P4ha3 APN 7 100305933 missense probably damaging 1.00
IGL01875:P4ha3 APN 7 100300652 missense probably damaging 0.97
IGL02265:P4ha3 APN 7 100293932 missense probably benign
IGL02957:P4ha3 APN 7 100318905 splice site probably benign
IGL03279:P4ha3 APN 7 100300686 missense probably damaging 1.00
R0006:P4ha3 UTSW 7 100318948 nonsense probably null
R0880:P4ha3 UTSW 7 100305909 missense probably benign 0.06
R1066:P4ha3 UTSW 7 100318063 missense possibly damaging 0.77
R1118:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1119:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1613:P4ha3 UTSW 7 100313250 missense possibly damaging 0.95
R1778:P4ha3 UTSW 7 100300691 splice site probably null
R2042:P4ha3 UTSW 7 100300690 critical splice donor site probably null
R3437:P4ha3 UTSW 7 100285624 missense possibly damaging 0.93
R4393:P4ha3 UTSW 7 100305607 missense probably benign 0.06
R5411:P4ha3 UTSW 7 100293815 missense probably damaging 1.00
R5722:P4ha3 UTSW 7 100305991 missense probably benign 0.03
R6209:P4ha3 UTSW 7 100317085 missense probably benign 0.09
R6462:P4ha3 UTSW 7 100314666 missense probably damaging 1.00
R6606:P4ha3 UTSW 7 100305644 missense probably damaging 0.99
R7578:P4ha3 UTSW 7 100293914 missense probably benign 0.02
R7769:P4ha3 UTSW 7 100285717 missense probably damaging 0.97
R8031:P4ha3 UTSW 7 100292698 missense probably damaging 1.00
RF033:P4ha3 UTSW 7 100310810 frame shift probably null
Z1177:P4ha3 UTSW 7 100293788 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CATGAGTGAAATGCCCATTGCCTG -3'
(R):5'- TCCCTATGGCAAGAGCATGGGAAG -3'

Sequencing Primer
(F):5'- AAATGCCCATTGCCTGTGTTTG -3'
(R):5'- GCAATGCAGTCTTAGTGATCTACC -3'
Posted On2014-01-29