Incidental Mutation 'R1236:Olfr906'
ID 152434
Institutional Source Beutler Lab
Gene Symbol Olfr906
Ensembl Gene ENSMUSG00000039962
Gene Name olfactory receptor 906
Synonyms MOR167-2, GA_x6K02T2PVTD-32194085-32195020
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R1236 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38487085-38491560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38488229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 67 (S67P)
Ref Sequence ENSEMBL: ENSMUSP00000151008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045493] [ENSMUST00000214344]
AlphaFold K7N5P3
Predicted Effect probably damaging
Transcript: ENSMUST00000045493
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039040
Gene: ENSMUSG00000039962
AA Change: S67P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-50 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214344
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Olfr906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03127:Olfr906 APN 9 38488586 missense probably benign 0.13
R0948:Olfr906 UTSW 9 38488948 missense probably benign 0.00
R1246:Olfr906 UTSW 9 38488790 missense probably damaging 1.00
R1442:Olfr906 UTSW 9 38488643 missense probably benign 0.10
R2016:Olfr906 UTSW 9 38488013 critical splice acceptor site probably null
R2264:Olfr906 UTSW 9 38488055 missense possibly damaging 0.50
R2268:Olfr906 UTSW 9 38488208 missense probably damaging 1.00
R3853:Olfr906 UTSW 9 38488951 missense probably benign 0.18
R4066:Olfr906 UTSW 9 38488482 missense probably benign 0.17
R4594:Olfr906 UTSW 9 38488761 missense probably damaging 0.98
R5192:Olfr906 UTSW 9 38488805 missense possibly damaging 0.69
R5436:Olfr906 UTSW 9 38488539 missense probably benign 0.31
R5598:Olfr906 UTSW 9 38488525 missense possibly damaging 0.77
R5694:Olfr906 UTSW 9 38488236 missense probably damaging 1.00
R5914:Olfr906 UTSW 9 38488361 missense probably damaging 1.00
R5959:Olfr906 UTSW 9 38488911 missense probably damaging 1.00
R6318:Olfr906 UTSW 9 38488377 missense probably benign
R6870:Olfr906 UTSW 9 38488086 missense probably benign 0.19
R7482:Olfr906 UTSW 9 38488451 missense probably damaging 0.99
R7571:Olfr906 UTSW 9 38488656 missense probably benign 0.08
R7917:Olfr906 UTSW 9 38488609 nonsense probably null
R8837:Olfr906 UTSW 9 38488301 missense probably benign 0.05
R9562:Olfr906 UTSW 9 38488796 missense possibly damaging 0.45
R9628:Olfr906 UTSW 9 38488575 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGATTGGCTTAACAGACCAGCCC -3'
(R):5'- GCACAAGGATATTGATGCCCACGAC -3'

Sequencing Primer
(F):5'- TTAACAGACCAGCCCAATCTC -3'
(R):5'- CCAGTTCATTGACATAGGTGC -3'
Posted On 2014-01-29