Incidental Mutation 'R1236:Rufy2'
ID152435
Institutional Source Beutler Lab
Gene Symbol Rufy2
Ensembl Gene ENSMUSG00000020070
Gene NameRUN and FYVE domain-containing 2
Synonyms2610111M19Rik, LZ-FYVE, ZFYVE13, Denn
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1236 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62980223-63017210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62994770 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 217 (N217S)
Ref Sequence ENSEMBL: ENSMUSP00000113429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062600] [ENSMUST00000119567] [ENSMUST00000122231] [ENSMUST00000131718] [ENSMUST00000143594]
Predicted Effect probably benign
Transcript: ENSMUST00000062600
AA Change: N217S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059982
Gene: ENSMUSG00000020070
AA Change: N217S

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119567
AA Change: N217S

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113429
Gene: ENSMUSG00000020070
AA Change: N217S

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 515 N/A INTRINSIC
FYVE 532 599 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122231
AA Change: N183S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113754
Gene: ENSMUSG00000020070
AA Change: N183S

DomainStartEndE-ValueType
Pfam:RUN 45 100 6.2e-9 PFAM
low complexity region 110 123 N/A INTRINSIC
coiled coil region 176 234 N/A INTRINSIC
coiled coil region 292 372 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129470
Predicted Effect probably benign
Transcript: ENSMUST00000131718
AA Change: N217S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000121419
Gene: ENSMUSG00000020070
AA Change: N217S

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143594
AA Change: N217S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070
AA Change: N217S

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148259
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Rufy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Rufy2 APN 10 62991054 missense probably damaging 0.98
IGL01516:Rufy2 APN 10 63011433 missense possibly damaging 0.82
IGL02811:Rufy2 APN 10 63000327 missense probably damaging 1.00
IGL03244:Rufy2 APN 10 63004704 missense probably benign 0.08
PIT4434001:Rufy2 UTSW 10 62991066 missense possibly damaging 0.60
R0071:Rufy2 UTSW 10 62989167 missense possibly damaging 0.95
R0448:Rufy2 UTSW 10 63004736 missense probably benign
R0496:Rufy2 UTSW 10 62993170 missense probably damaging 1.00
R0723:Rufy2 UTSW 10 62998094 missense probably benign 0.43
R0731:Rufy2 UTSW 10 63011844 critical splice donor site probably benign
R1414:Rufy2 UTSW 10 63002199 nonsense probably null
R1600:Rufy2 UTSW 10 63006671 missense probably benign 0.00
R1626:Rufy2 UTSW 10 62995372 missense probably benign 0.43
R2035:Rufy2 UTSW 10 63006747 missense probably damaging 0.99
R2141:Rufy2 UTSW 10 62990994 missense probably damaging 1.00
R2962:Rufy2 UTSW 10 63000260 missense probably damaging 0.96
R3874:Rufy2 UTSW 10 62998137 missense probably damaging 1.00
R4206:Rufy2 UTSW 10 63004772 nonsense probably null
R4321:Rufy2 UTSW 10 62982680 missense probably damaging 1.00
R4878:Rufy2 UTSW 10 63002211 missense probably damaging 1.00
R5636:Rufy2 UTSW 10 62997954 missense probably damaging 1.00
R7382:Rufy2 UTSW 10 62997969 missense probably benign 0.04
R7714:Rufy2 UTSW 10 63002993 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGGTCACTGATGCACTGCAC -3'
(R):5'- AGCAGGTAAGGCGGGTTTTAGC -3'

Sequencing Primer
(F):5'- tgtagccctggttgtcttg -3'
(R):5'- ctctacctctacttccctctttg -3'
Posted On2014-01-29