Incidental Mutation 'R1236:Atp5s'
ID152439
Institutional Source Beutler Lab
Gene Symbol Atp5s
Ensembl Gene ENSMUSG00000054894
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit S
Synonyms1110015E18Rik, facyor B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1236 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69724950-69744660 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 69741818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021372] [ENSMUST00000220460] [ENSMUST00000220539] [ENSMUST00000220916] [ENSMUST00000222950]
Predicted Effect probably null
Transcript: ENSMUST00000021372
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000220460
Predicted Effect probably benign
Transcript: ENSMUST00000220539
Predicted Effect probably null
Transcript: ENSMUST00000220916
Predicted Effect probably benign
Transcript: ENSMUST00000222950
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. This gene encodes the subunit s, also known as factor B, of the proton channel. This subunit is necessary for the energy transduction activity of the ATP synthase complexes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Atp5s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Atp5s APN 12 69741045 missense probably benign 0.00
R0344:Atp5s UTSW 12 69740889 unclassified probably benign
R0848:Atp5s UTSW 12 69741810 missense probably benign 0.30
R1539:Atp5s UTSW 12 69741071 missense probably benign 0.04
R2143:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R2144:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R2145:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R5957:Atp5s UTSW 12 69743784 missense probably benign
R7157:Atp5s UTSW 12 69741788 missense probably benign 0.06
R7257:Atp5s UTSW 12 69741669 missense probably damaging 1.00
Z1177:Atp5s UTSW 12 69740962 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCATAGGACAGTCAGAGACAGGACAG -3'
(R):5'- CAAGTGTTAcaggtgaaaatgaggcca -3'

Sequencing Primer
(F):5'- CAGTCCTGTCCTAAGTGAACTGAG -3'
(R):5'- ccaggaagcccagcaac -3'
Posted On2014-01-29