Incidental Mutation 'R1236:Prlr'
ID 152444
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Name prolactin receptor
Synonyms Prlr-rs1, Pr-1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R1236 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 10177324-10349266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 10325367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 180 (T180K)
Ref Sequence ENSEMBL: ENSMUSP00000118355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000127467] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000134410] [ENSMUST00000137867] [ENSMUST00000148257]
AlphaFold Q08501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000005400
Predicted Effect probably benign
Transcript: ENSMUST00000124470
AA Change: T180K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: T180K

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127467
SMART Domains Protein: ENSMUSP00000116211
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 59 143 3.78e0 SMART
Blast:FN3 158 185 7e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128450
AA Change: T180K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268
AA Change: T180K

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
AA Change: T180K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268
AA Change: T180K

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134410
SMART Domains Protein: ENSMUSP00000120417
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
AA Change: T180K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268
AA Change: T180K

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145428
Predicted Effect probably benign
Transcript: ENSMUST00000148257
AA Change: T180K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268
AA Change: T180K

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,685,756 (GRCm39) Y360C probably damaging Het
Afap1l2 T A 19: 56,904,904 (GRCm39) H566L possibly damaging Het
Aqr G T 2: 113,947,136 (GRCm39) F1015L probably damaging Het
Cep112 T A 11: 108,750,200 (GRCm39) L901H probably damaging Het
Col26a1 A G 5: 136,783,780 (GRCm39) V229A probably benign Het
Cyp4a14 T C 4: 115,349,367 (GRCm39) N231S probably benign Het
Dmac2l T C 12: 69,788,592 (GRCm39) probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gm37240 T A 3: 84,435,003 (GRCm39) N13I probably benign Het
Kbtbd7 G T 14: 79,665,272 (GRCm39) C368F probably benign Het
Kyat3 A G 3: 142,444,020 (GRCm39) D418G probably benign Het
Lpcat2 A G 8: 93,613,197 (GRCm39) M246V probably damaging Het
Nbas T A 12: 13,319,242 (GRCm39) W31R probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Npepl1 T A 2: 173,956,273 (GRCm39) probably null Het
Or6c212 A G 10: 129,558,675 (GRCm39) V246A probably damaging Het
Or8b1 T C 9: 38,399,525 (GRCm39) S67P probably damaging Het
P4ha3 T C 7: 99,943,056 (GRCm39) L147P probably damaging Het
Pkp2 C A 16: 16,043,766 (GRCm39) H173Q probably benign Het
Psph A G 5: 129,848,540 (GRCm39) M47T probably damaging Het
Rufy2 A G 10: 62,830,549 (GRCm39) N217S probably benign Het
Sgcg T C 14: 61,483,219 (GRCm39) M61V probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spint1 A G 2: 119,076,054 (GRCm39) T217A probably benign Het
Tert T C 13: 73,784,498 (GRCm39) L648P probably damaging Het
Vwde A T 6: 13,187,152 (GRCm39) Y778* probably null Het
Zeb2 T A 2: 44,884,658 (GRCm39) D967V probably damaging Het
Zfp687 T C 3: 94,919,355 (GRCm39) N139S probably benign Het
Zscan26 T C 13: 21,629,940 (GRCm39) M188V probably benign Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10,328,410 (GRCm39) missense probably benign 0.00
IGL00688:Prlr APN 15 10,322,467 (GRCm39) unclassified probably benign
IGL01527:Prlr APN 15 10,329,257 (GRCm39) missense probably benign 0.28
IGL01626:Prlr APN 15 10,328,804 (GRCm39) missense probably benign 0.12
IGL01660:Prlr APN 15 10,317,676 (GRCm39) missense probably damaging 1.00
IGL01835:Prlr APN 15 10,329,129 (GRCm39) missense probably damaging 1.00
IGL01926:Prlr APN 15 10,314,306 (GRCm39) start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10,328,428 (GRCm39) missense possibly damaging 0.95
IGL02306:Prlr APN 15 10,328,760 (GRCm39) missense probably benign 0.05
IGL02394:Prlr APN 15 10,328,664 (GRCm39) missense probably benign 0.03
IGL02430:Prlr APN 15 10,325,477 (GRCm39) missense probably damaging 1.00
IGL02695:Prlr APN 15 10,328,451 (GRCm39) missense probably benign 0.20
IGL02745:Prlr APN 15 10,328,680 (GRCm39) missense possibly damaging 0.50
IGL03193:Prlr APN 15 10,328,376 (GRCm39) missense possibly damaging 0.57
IGL03277:Prlr APN 15 10,328,887 (GRCm39) missense probably benign 0.01
IGL03379:Prlr APN 15 10,319,403 (GRCm39) missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10,328,458 (GRCm39) missense probably damaging 1.00
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0545:Prlr UTSW 15 10,317,652 (GRCm39) missense probably damaging 1.00
R1352:Prlr UTSW 15 10,328,872 (GRCm39) missense probably benign
R1524:Prlr UTSW 15 10,319,419 (GRCm39) missense probably damaging 0.97
R1537:Prlr UTSW 15 10,328,364 (GRCm39) splice site probably null
R1690:Prlr UTSW 15 10,317,676 (GRCm39) missense probably damaging 1.00
R1773:Prlr UTSW 15 10,325,404 (GRCm39) nonsense probably null
R1789:Prlr UTSW 15 10,322,622 (GRCm39) missense probably benign 0.32
R2421:Prlr UTSW 15 10,319,343 (GRCm39) missense probably damaging 1.00
R4518:Prlr UTSW 15 10,329,085 (GRCm39) missense possibly damaging 0.53
R4621:Prlr UTSW 15 10,319,462 (GRCm39) intron probably benign
R4855:Prlr UTSW 15 10,328,883 (GRCm39) missense probably benign 0.01
R4957:Prlr UTSW 15 10,319,281 (GRCm39) missense probably damaging 1.00
R5053:Prlr UTSW 15 10,325,471 (GRCm39) missense probably benign 0.00
R5731:Prlr UTSW 15 10,314,221 (GRCm39) missense probably benign 0.00
R5749:Prlr UTSW 15 10,328,804 (GRCm39) missense probably benign 0.12
R5806:Prlr UTSW 15 10,319,290 (GRCm39) missense probably damaging 1.00
R5927:Prlr UTSW 15 10,322,532 (GRCm39) missense probably benign 0.42
R6170:Prlr UTSW 15 10,328,935 (GRCm39) missense probably benign 0.05
R6911:Prlr UTSW 15 10,329,270 (GRCm39) missense probably benign
R6935:Prlr UTSW 15 10,319,388 (GRCm39) missense probably damaging 1.00
R7327:Prlr UTSW 15 10,346,524 (GRCm39) missense probably benign 0.00
R7539:Prlr UTSW 15 10,329,109 (GRCm39) missense probably benign 0.11
R7579:Prlr UTSW 15 10,329,021 (GRCm39) missense probably benign 0.08
R7615:Prlr UTSW 15 10,326,010 (GRCm39) missense probably damaging 1.00
R7651:Prlr UTSW 15 10,328,464 (GRCm39) missense probably benign 0.26
R8213:Prlr UTSW 15 10,329,328 (GRCm39) missense possibly damaging 0.95
R8537:Prlr UTSW 15 10,314,266 (GRCm39) start gained probably benign
R9015:Prlr UTSW 15 10,319,352 (GRCm39) missense probably damaging 1.00
R9252:Prlr UTSW 15 10,326,550 (GRCm39) splice site probably benign
R9335:Prlr UTSW 15 10,325,357 (GRCm39) missense probably benign 0.08
R9341:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
R9343:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
Z1176:Prlr UTSW 15 10,314,341 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCACCAAGTATCCTGTTGTGGTTT -3'
(R):5'- TGACCAGTGAGTCCTTGGAAGACAT -3'

Sequencing Primer
(F):5'- gtttttctgtgctgccctg -3'
(R):5'- GTTTGCCAACTGTGACTCAAG -3'
Posted On 2014-01-29