Incidental Mutation 'R1236:Afap1l2'
ID152446
Institutional Source Beutler Lab
Gene Symbol Afap1l2
Ensembl Gene ENSMUSG00000025083
Gene Nameactin filament associated protein 1-like 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1236 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56912361-57008228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56916472 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 566 (H566L)
Ref Sequence ENSEMBL: ENSMUSP00000107210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect probably benign
Transcript: ENSMUST00000026068
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111584
AA Change: H566L

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: H566L

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118800
AA Change: H548L

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: H548L

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122359
AA Change: H492L

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: H492L

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155467
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Sgcg T C 14: 61,245,770 M61V probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Afap1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Afap1l2 APN 19 57002308 splice site probably benign
IGL01012:Afap1l2 APN 19 56930261 missense probably damaging 0.98
IGL01089:Afap1l2 APN 19 56913411 splice site probably null
IGL01150:Afap1l2 APN 19 56930186 missense probably damaging 0.99
IGL02393:Afap1l2 APN 19 56914440 missense probably damaging 1.00
IGL02887:Afap1l2 APN 19 56920563 missense probably damaging 1.00
IGL03060:Afap1l2 APN 19 56914250 nonsense probably null
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0282:Afap1l2 UTSW 19 56916221 missense possibly damaging 0.65
R0388:Afap1l2 UTSW 19 56917242 splice site probably benign
R0432:Afap1l2 UTSW 19 56917119 splice site probably benign
R0497:Afap1l2 UTSW 19 56930209 missense probably benign 0.27
R0578:Afap1l2 UTSW 19 56915782 missense probably benign 0.04
R0631:Afap1l2 UTSW 19 56916085 missense probably benign 0.39
R0670:Afap1l2 UTSW 19 56915803 missense probably damaging 1.00
R1188:Afap1l2 UTSW 19 56925069 missense probably damaging 0.97
R1274:Afap1l2 UTSW 19 56914563 missense probably benign 0.02
R1463:Afap1l2 UTSW 19 56930151 missense probably benign 0.01
R1497:Afap1l2 UTSW 19 56928311 missense probably benign 0.25
R1597:Afap1l2 UTSW 19 56914449 missense probably benign 0.14
R1778:Afap1l2 UTSW 19 56916206 missense possibly damaging 0.68
R1795:Afap1l2 UTSW 19 56928409 missense probably damaging 1.00
R1991:Afap1l2 UTSW 19 57002267 missense possibly damaging 0.62
R2113:Afap1l2 UTSW 19 56913389 missense possibly damaging 0.95
R2242:Afap1l2 UTSW 19 56914468 missense possibly damaging 0.56
R3429:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3430:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3698:Afap1l2 UTSW 19 56916523 missense possibly damaging 0.69
R4706:Afap1l2 UTSW 19 56937240 missense possibly damaging 0.76
R4956:Afap1l2 UTSW 19 56943447 missense probably benign 0.00
R4993:Afap1l2 UTSW 19 56918040 missense probably damaging 1.00
R5772:Afap1l2 UTSW 19 56922974 missense probably benign 0.02
R5878:Afap1l2 UTSW 19 56915675 missense probably benign 0.01
R6194:Afap1l2 UTSW 19 56922951 missense probably damaging 1.00
R6226:Afap1l2 UTSW 19 56916128 missense probably benign 0.00
R6334:Afap1l2 UTSW 19 56917976 unclassified probably null
R6439:Afap1l2 UTSW 19 56928386 missense possibly damaging 0.91
R7332:Afap1l2 UTSW 19 56918121 missense probably damaging 1.00
R7524:Afap1l2 UTSW 19 56918111 missense probably damaging 1.00
X0062:Afap1l2 UTSW 19 56918033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACTCTTGAACCTCTGGTTGCC -3'
(R):5'- AGAATGCTGTGTTCTGAGCCTTCTG -3'

Sequencing Primer
(F):5'- TTGCCTCTGCCAAGACAG -3'
(R):5'- GACTCTGGGCTCTGACATC -3'
Posted On2014-01-29