Incidental Mutation 'R1237:Prdx6b'
ID152450
Institutional Source Beutler Lab
Gene Symbol Prdx6b
Ensembl Gene ENSMUSG00000050114
Gene Nameperoxiredoxin 6B
Synonyms4930414C22Rik, Prdx6-ps1, Aop2-rs1, 1-cysPrx-P1
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location80292472-80295356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80293176 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 110 (I110V)
Ref Sequence ENSEMBL: ENSMUSP00000133276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057072]
Predicted Effect probably benign
Transcript: ENSMUST00000057072
AA Change: I110V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133276
Gene: ENSMUSG00000050114
AA Change: I110V

DomainStartEndE-ValueType
Pfam:Redoxin 6 164 6.9e-10 PFAM
Pfam:AhpC-TSA 7 146 3.7e-30 PFAM
Pfam:1-cysPrx_C 166 205 4.2e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This intronless gene is similar to the multi-exon peroxiredoxin 6 gene located on chromosome 1. It is transcribed and the ORF is intact compared to that of the peroxiredoxin 6 gene. This gene could be considered a transcribed pseudogene based on a failure to detect the protein in vivo in PMID:14644414. However, NCBI is representing the protein due to mass spectrometry data in PMID:18614015, which detected at least one peptide that is specific for this protein. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Prdx6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Prdx6b APN 2 80293195 missense probably damaging 1.00
IGL01710:Prdx6b APN 2 80293146 missense probably damaging 1.00
R0410:Prdx6b UTSW 2 80293029 missense probably damaging 1.00
R0530:Prdx6b UTSW 2 80293315 missense probably damaging 1.00
R1797:Prdx6b UTSW 2 80293202 missense possibly damaging 0.94
R2136:Prdx6b UTSW 2 80293163 missense probably damaging 0.99
R4707:Prdx6b UTSW 2 80293060 missense probably damaging 1.00
R7440:Prdx6b UTSW 2 80293216 missense probably damaging 0.99
R7565:Prdx6b UTSW 2 80292990 missense probably damaging 0.99
R7724:Prdx6b UTSW 2 80293402 missense probably benign 0.01
R7814:Prdx6b UTSW 2 80292960 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAACTTGGTAGAGCTGCAAAGCTG -3'
(R):5'- CCCTTCTTCCAATCAACTGGGGTG -3'

Sequencing Primer
(F):5'- GTGTTGAGGATCATCTTGCCTG -3'
(R):5'- ATCAACTGGGGTGGCAACC -3'
Posted On2014-01-29