Incidental Mutation 'R1237:Ccnc'
ID152452
Institutional Source Beutler Lab
Gene Symbol Ccnc
Ensembl Gene ENSMUSG00000028252
Gene Namecyclin C
Synonyms
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location21727701-21759922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21730457 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 31 (F31L)
Ref Sequence ENSEMBL: ENSMUSP00000113682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065928] [ENSMUST00000102997] [ENSMUST00000108240] [ENSMUST00000120679]
Predicted Effect probably benign
Transcript: ENSMUST00000065928
AA Change: F31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069076
Gene: ENSMUSG00000028252
AA Change: F31L

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102997
AA Change: F31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100062
Gene: ENSMUSG00000028252
AA Change: F31L

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108240
AA Change: F31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103875
Gene: ENSMUSG00000028252
AA Change: F31L

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120679
AA Change: F31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113682
Gene: ENSMUSG00000028252
AA Change: F31L

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145288
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin family of proteins. The encoded protein interacts with cyclin-dependent kinase 8 and induces the phophorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die prenatally and exhibit growth retardation and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Ccnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ccnc APN 4 21742642 nonsense probably null
IGL01536:Ccnc APN 4 21732505 missense probably benign 0.01
IGL03083:Ccnc APN 4 21742683 missense possibly damaging 0.83
R1220:Ccnc UTSW 4 21732491 missense probably damaging 1.00
R1558:Ccnc UTSW 4 21742671 missense probably benign 0.31
R2012:Ccnc UTSW 4 21741955 missense possibly damaging 0.65
R4901:Ccnc UTSW 4 21727894 missense probably damaging 0.96
R6427:Ccnc UTSW 4 21747578 critical splice donor site probably null
R6509:Ccnc UTSW 4 21740642 missense probably benign 0.27
R7421:Ccnc UTSW 4 21743291 missense probably damaging 1.00
R7563:Ccnc UTSW 4 21732220 missense probably damaging 0.99
R7842:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R7925:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R8023:Ccnc UTSW 4 21747578 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTAAACTGGTGCTCTACCTCAGC -3'
(R):5'- AGGTGCGAAAAGTATTACCCAGAACAC -3'

Sequencing Primer
(F):5'- tggtggtgatggggagg -3'
(R):5'- AAGTATTACCCAGAACACTGAAATG -3'
Posted On2014-01-29