Incidental Mutation 'R1237:Ccdc174'
List [record 1 of 39] next >> last >|
ID152457
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Namecoiled-coil domain containing 174
Synonyms
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91878053-91899843 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 91890787 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090]
Predicted Effect probably benign
Transcript: ENSMUST00000037783
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151378
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91880362 critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91898282 missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91899557 missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91890853 missense probably benign
R0482:Ccdc174 UTSW 6 91895266 missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91890892 splice site probably benign
R0801:Ccdc174 UTSW 6 91895332 missense possibly damaging 0.72
R1124:Ccdc174 UTSW 6 91899580 missense probably benign 0.33
R1388:Ccdc174 UTSW 6 91881244 splice site probably null
R2176:Ccdc174 UTSW 6 91888089 missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91899357 missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91885356 nonsense probably null
R4775:Ccdc174 UTSW 6 91890894 splice site probably null
R4880:Ccdc174 UTSW 6 91899591 unclassified probably benign
R5579:Ccdc174 UTSW 6 91881350 splice site probably null
R5787:Ccdc174 UTSW 6 91881310 nonsense probably null
R5869:Ccdc174 UTSW 6 91885418 utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91880291 missense probably damaging 1.00
RF008:Ccdc174 UTSW 6 91899366 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGGCACAGCAAGCTTAGTGAGTC -3'
(R):5'- CAGGTTGTTCCCTGAGCACAGAAG -3'

Sequencing Primer
(F):5'- GCAAGCTTAGTGAGTCTCAGC -3'
(R):5'- GTTCCCTGAGCACAGAAGATTATG -3'
Posted On2014-01-29