Incidental Mutation 'R1237:Slc22a21'
ID152466
Institutional Source Beutler Lab
Gene Symbol Slc22a21
Ensembl Gene ENSMUSG00000063652
Gene Namesolute carrier family 22 (organic cation transporter), member 21
SynonymsOctn3, Slc22a9
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1237 (G1)
Quality Score220
Status Validated
Chromosome11
Chromosomal Location53949965-53980332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53979772 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 29 (I29T)
Ref Sequence ENSEMBL: ENSMUSP00000123180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020586] [ENSMUST00000076493] [ENSMUST00000124221]
Predicted Effect probably benign
Transcript: ENSMUST00000020586
SMART Domains Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 60 524 2.7e-30 PFAM
Pfam:MFS_1 139 478 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076493
AA Change: I29T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075814
Gene: ENSMUSG00000063652
AA Change: I29T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 74 527 3.1e-31 PFAM
Pfam:MFS_1 139 376 3e-13 PFAM
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124221
AA Change: I29T

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123180
Gene: ENSMUSG00000063652
AA Change: I29T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Meta Mutation Damage Score 0.1548 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Slc22a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Slc22a21 APN 11 53979581 missense probably damaging 1.00
R0025:Slc22a21 UTSW 11 53979688 missense probably damaging 1.00
R0104:Slc22a21 UTSW 11 53951809 missense probably null 0.88
R0285:Slc22a21 UTSW 11 53959196 splice site probably benign
R0562:Slc22a21 UTSW 11 53979620 nonsense probably null
R0569:Slc22a21 UTSW 11 53951810 missense probably benign 0.00
R2131:Slc22a21 UTSW 11 53979733 missense probably damaging 1.00
R2327:Slc22a21 UTSW 11 53951304 missense probably benign 0.25
R2991:Slc22a21 UTSW 11 53959369 missense probably damaging 1.00
R4209:Slc22a21 UTSW 11 53956055 missense probably benign 0.00
R4290:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4291:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4292:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4294:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4295:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4470:Slc22a21 UTSW 11 53956013 missense probably benign 0.00
R5194:Slc22a21 UTSW 11 53979847 missense probably damaging 1.00
R5214:Slc22a21 UTSW 11 53953043 missense probably damaging 0.99
R5698:Slc22a21 UTSW 11 53951349 missense probably benign 0.04
R6169:Slc22a21 UTSW 11 53958087 missense probably damaging 1.00
R6200:Slc22a21 UTSW 11 53958038 missense probably damaging 1.00
R6767:Slc22a21 UTSW 11 53979502 missense probably damaging 1.00
R6845:Slc22a21 UTSW 11 53979640 missense probably benign 0.01
R7109:Slc22a21 UTSW 11 53979503 missense possibly damaging 0.88
R7402:Slc22a21 UTSW 11 53960400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGCTCAGAGAAGTTGGCGATG -3'
(R):5'- TCTCGAACTCCTCTTCGACGAGTG -3'

Sequencing Primer
(F):5'- AGAAGTTGGCGATGGTGGC -3'
(R):5'- CTCTTCGACGAGTGACTGG -3'
Posted On2014-01-29