Incidental Mutation 'R1237:Ankrd13b'
ID152467
Institutional Source Beutler Lab
Gene Symbol Ankrd13b
Ensembl Gene ENSMUSG00000037907
Gene Nameankyrin repeat domain 13b
Synonyms
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77470485-77489678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77474574 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 70 (T70A)
Ref Sequence ENSEMBL: ENSMUSP00000119633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037593] [ENSMUST00000052515] [ENSMUST00000092892] [ENSMUST00000102493] [ENSMUST00000108391] [ENSMUST00000145934]
Predicted Effect probably damaging
Transcript: ENSMUST00000037593
AA Change: T285A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073584
Gene: ENSMUSG00000037907
AA Change: T285A

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 491 5.5e-111 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 552 580 N/A INTRINSIC
UIM 585 604 3.15e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052515
SMART Domains Protein: ENSMUSP00000056862
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 217 351 1.19e-91 SMART
low complexity region 374 389 N/A INTRINSIC
coiled coil region 390 424 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092892
AA Change: T285A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090568
Gene: ENSMUSG00000037907
AA Change: T285A

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 490 3.2e-110 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102493
SMART Domains Protein: ENSMUSP00000099551
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108391
SMART Domains Protein: ENSMUSP00000104028
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000127291
AA Change: T32A
SMART Domains Protein: ENSMUSP00000118247
Gene: ENSMUSG00000037907
AA Change: T32A

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 120 9.7e-31 PFAM
low complexity region 121 133 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143872
Predicted Effect probably damaging
Transcript: ENSMUST00000145934
AA Change: T70A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119633
Gene: ENSMUSG00000037907
AA Change: T70A

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 2 276 9.7e-90 PFAM
UIM 288 307 1.81e-1 SMART
Meta Mutation Damage Score 0.1283 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Ankrd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ankrd13b APN 11 77472752 missense probably damaging 1.00
IGL01396:Ankrd13b APN 11 77472372 unclassified probably null
IGL02731:Ankrd13b APN 11 77476219 missense probably damaging 0.99
R0310:Ankrd13b UTSW 11 77472745 missense possibly damaging 0.71
R0496:Ankrd13b UTSW 11 77473041 missense probably damaging 1.00
R0511:Ankrd13b UTSW 11 77473288 missense possibly damaging 0.89
R0831:Ankrd13b UTSW 11 77472759 missense probably damaging 0.99
R1156:Ankrd13b UTSW 11 77472861 missense probably damaging 1.00
R2259:Ankrd13b UTSW 11 77476342 missense probably damaging 1.00
R3110:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R3112:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R4190:Ankrd13b UTSW 11 77476375 missense probably damaging 1.00
R4471:Ankrd13b UTSW 11 77476214 missense probably damaging 1.00
R4599:Ankrd13b UTSW 11 77471668 missense probably benign
R5253:Ankrd13b UTSW 11 77473235 intron probably benign
R5677:Ankrd13b UTSW 11 77477544 missense probably damaging 0.99
R7073:Ankrd13b UTSW 11 77472509 missense probably benign 0.39
R7388:Ankrd13b UTSW 11 77472757 missense probably benign 0.02
R7417:Ankrd13b UTSW 11 77476194 missense probably damaging 0.97
R7592:Ankrd13b UTSW 11 77476501 missense probably benign 0.45
R7596:Ankrd13b UTSW 11 77472314 missense probably benign 0.18
R7643:Ankrd13b UTSW 11 77473085 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTGAGCCATCCTGGCACTGG -3'
(R):5'- GGCAGAGGTCCCCTCTAAGACG -3'

Sequencing Primer
(F):5'- TTACAGCACCTGTCCTCACTTG -3'
(R):5'- acttccatactactgttcatcacc -3'
Posted On2014-01-29