Incidental Mutation 'R1237:Vmn1r212'
ID152471
Institutional Source Beutler Lab
Gene Symbol Vmn1r212
Ensembl Gene ENSMUSG00000071490
Gene Namevomeronasal 1 receptor 212
SynonymsV1rh18
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22883042-22884205 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 22883468 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 232 (Q232*)
Ref Sequence ENSEMBL: ENSMUSP00000093655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095960]
Predicted Effect probably null
Transcript: ENSMUST00000095960
AA Change: Q232*
SMART Domains Protein: ENSMUSP00000093655
Gene: ENSMUSG00000071490
AA Change: Q232*

DomainStartEndE-ValueType
Pfam:TAS2R 2 292 1.2e-7 PFAM
Pfam:V1R 34 297 5.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226881
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Vmn1r212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Vmn1r212 APN 13 22883159 missense unknown
IGL01678:Vmn1r212 APN 13 22883911 missense probably damaging 1.00
R0798:Vmn1r212 UTSW 13 22883698 missense probably damaging 1.00
R1331:Vmn1r212 UTSW 13 22883392 missense probably benign 0.33
R2064:Vmn1r212 UTSW 13 22884115 missense probably benign 0.28
R2356:Vmn1r212 UTSW 13 22883950 nonsense probably null
R2846:Vmn1r212 UTSW 13 22884092 missense probably damaging 0.99
R3896:Vmn1r212 UTSW 13 22883897 missense probably benign 0.00
R3937:Vmn1r212 UTSW 13 22883188 missense unknown
R4722:Vmn1r212 UTSW 13 22883908 missense probably damaging 1.00
R5233:Vmn1r212 UTSW 13 22883134 missense unknown
R6043:Vmn1r212 UTSW 13 22884088 missense probably damaging 0.98
R7199:Vmn1r212 UTSW 13 22883561 missense probably benign 0.12
R7413:Vmn1r212 UTSW 13 22883548 missense probably damaging 1.00
R7840:Vmn1r212 UTSW 13 22883153 missense unknown
R7923:Vmn1r212 UTSW 13 22883153 missense unknown
R8054:Vmn1r212 UTSW 13 22883765 missense probably benign 0.25
Z1088:Vmn1r212 UTSW 13 22883762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCCATCCCTGTGAATCAGCAC -3'
(R):5'- AGGCCAAAGTCTGTATGGCACATC -3'

Sequencing Primer
(F):5'- CTGTGAATCAGCACCAGGG -3'
(R):5'- CTGAATGTATCACAGCTTAGGAGTG -3'
Posted On2014-01-29