Incidental Mutation 'R1237:Vmn2r107'
ID152479
Institutional Source Beutler Lab
Gene Symbol Vmn2r107
Ensembl Gene ENSMUSG00000056910
Gene Namevomeronasal 2, receptor 107
SynonymsV2r6
MMRRC Submission 039304-MU
Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20345425-20375772 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 20356685 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 315 (L315*)
Ref Sequence ENSEMBL: ENSMUSP00000048706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042090]
Predicted Effect probably null
Transcript: ENSMUST00000042090
AA Change: L315*
SMART Domains Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: L315*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 466 3.6e-40 PFAM
Pfam:NCD3G 509 562 5.1e-21 PFAM
Pfam:7tm_3 593 830 8e-51 PFAM
Meta Mutation Damage Score 0.6612 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Vmn2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Vmn2r107 APN 17 20375747 missense probably damaging 0.98
IGL01768:Vmn2r107 APN 17 20345606 missense probably benign 0.32
IGL02086:Vmn2r107 APN 17 20357800 missense probably benign 0.00
IGL02136:Vmn2r107 APN 17 20374906 missense probably benign 0.02
IGL02266:Vmn2r107 APN 17 20356777 missense probably damaging 1.00
IGL02285:Vmn2r107 APN 17 20375561 missense probably damaging 1.00
IGL02724:Vmn2r107 APN 17 20356744 missense possibly damaging 0.49
IGL02998:Vmn2r107 APN 17 20357755 missense probably damaging 0.99
IGL03089:Vmn2r107 APN 17 20375712 missense probably benign 0.05
IGL03284:Vmn2r107 APN 17 20356911 missense probably benign 0.07
IGL03307:Vmn2r107 APN 17 20356776 missense probably benign 0.09
IGL03399:Vmn2r107 APN 17 20357958 splice site probably benign
3-1:Vmn2r107 UTSW 17 20345504 missense probably benign
R0285:Vmn2r107 UTSW 17 20345611 missense probably benign 0.00
R0455:Vmn2r107 UTSW 17 20374823 splice site probably benign
R0497:Vmn2r107 UTSW 17 20375132 missense probably damaging 1.00
R0506:Vmn2r107 UTSW 17 20357759 missense probably benign
R0621:Vmn2r107 UTSW 17 20374990 missense probably benign 0.01
R0667:Vmn2r107 UTSW 17 20355654 missense possibly damaging 0.91
R1118:Vmn2r107 UTSW 17 20356598 missense probably benign 0.03
R1204:Vmn2r107 UTSW 17 20357769 missense probably benign
R1485:Vmn2r107 UTSW 17 20374847 missense possibly damaging 0.95
R1783:Vmn2r107 UTSW 17 20356513 missense possibly damaging 0.51
R1873:Vmn2r107 UTSW 17 20345578 missense probably benign 0.10
R1974:Vmn2r107 UTSW 17 20355617 splice site probably null
R2009:Vmn2r107 UTSW 17 20375467 missense probably benign 0.01
R2029:Vmn2r107 UTSW 17 20375287 missense probably benign 0.01
R2164:Vmn2r107 UTSW 17 20375642 missense probably damaging 1.00
R2269:Vmn2r107 UTSW 17 20375555 missense possibly damaging 0.58
R3087:Vmn2r107 UTSW 17 20360345 missense probably benign 0.03
R3740:Vmn2r107 UTSW 17 20374889 missense probably benign 0.00
R3961:Vmn2r107 UTSW 17 20375455 missense probably damaging 1.00
R4031:Vmn2r107 UTSW 17 20375221 missense probably benign 0.00
R4270:Vmn2r107 UTSW 17 20355779 missense probably benign
R4963:Vmn2r107 UTSW 17 20375141 missense probably damaging 1.00
R5121:Vmn2r107 UTSW 17 20355753 missense probably benign 0.01
R5640:Vmn2r107 UTSW 17 20375164 missense probably damaging 1.00
R6007:Vmn2r107 UTSW 17 20375054 missense probably benign 0.19
R6238:Vmn2r107 UTSW 17 20345587 missense probably benign 0.43
R6298:Vmn2r107 UTSW 17 20355782 missense probably benign 0.00
R6467:Vmn2r107 UTSW 17 20375677 missense probably damaging 0.99
R6726:Vmn2r107 UTSW 17 20375375 missense probably damaging 0.96
R6782:Vmn2r107 UTSW 17 20356879 missense probably damaging 1.00
R7299:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7301:Vmn2r107 UTSW 17 20345616 missense probably benign 0.01
R7375:Vmn2r107 UTSW 17 20355876 missense probably benign
R7448:Vmn2r107 UTSW 17 20375732 missense probably benign 0.00
R7495:Vmn2r107 UTSW 17 20375009 missense possibly damaging 0.71
X0022:Vmn2r107 UTSW 17 20356968 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCTCCCAAGGACACATCTCTTTCAC -3'
(R):5'- AGCCACAGCGTACACAGCATTG -3'

Sequencing Primer
(F):5'- ATGATTCCTGCCACATGGAC -3'
(R):5'- CCAAAGAAGCATTTGTTTGACAGC -3'
Posted On2014-01-29