Incidental Mutation 'R1238:Ctcf'
ID 152497
Institutional Source Beutler Lab
Gene Symbol Ctcf
Ensembl Gene ENSMUSG00000005698
Gene Name CCCTC-binding factor
Synonyms
MMRRC Submission 039305-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1238 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 106363200-106409554 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 106397909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005841]
AlphaFold Q61164
Predicted Effect probably benign
Transcript: ENSMUST00000005841
SMART Domains Protein: ENSMUSP00000005841
Gene: ENSMUSG00000005698

DomainStartEndE-ValueType
low complexity region 116 131 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
low complexity region 250 264 N/A INTRINSIC
ZnF_C2H2 266 288 1.22e-4 SMART
ZnF_C2H2 294 316 7.26e-3 SMART
ZnF_C2H2 322 345 6.88e-4 SMART
ZnF_C2H2 351 373 5.14e-3 SMART
ZnF_C2H2 379 401 2.09e-3 SMART
ZnF_C2H2 407 430 2.02e-1 SMART
ZnF_C2H2 437 460 9.44e-2 SMART
ZnF_C2H2 467 489 7.67e-2 SMART
ZnF_C2H2 495 517 3.34e-2 SMART
ZnF_C2H2 523 546 2.53e-2 SMART
ZnF_C2H2 555 575 1.23e1 SMART
low complexity region 592 657 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156436
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele die prior at implantation. Mice homozygous for a conditional allele activated in T cells exhibit a defect in the transition from immature single positive T cells to double positive T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,835,051 (GRCm39) probably benign Het
BC051665 T A 13: 60,932,451 (GRCm39) N78I probably damaging Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Cep290 A C 10: 100,353,725 (GRCm39) Q819H probably damaging Het
Cep70 T C 9: 99,136,318 (GRCm39) I7T probably benign Het
Chd1l C T 3: 97,490,047 (GRCm39) E503K probably benign Het
Cit T A 5: 115,989,280 (GRCm39) F56I probably benign Het
Colec10 T C 15: 54,325,835 (GRCm39) F222L possibly damaging Het
Crocc G A 4: 140,762,675 (GRCm39) A769V probably benign Het
Ect2l T C 10: 18,018,852 (GRCm39) R607G possibly damaging Het
Efcab6 T G 15: 83,817,338 (GRCm39) E745A probably benign Het
Eif1ad T G 19: 5,420,111 (GRCm39) *171G probably null Het
Gvin-ps6 A G 7: 106,022,264 (GRCm39) V246A probably damaging Het
H2-D1 A G 17: 35,482,908 (GRCm39) D146G probably damaging Het
Iqub C T 6: 24,505,884 (GRCm39) R8H probably benign Het
Itih4 A T 14: 30,609,906 (GRCm39) I79F probably damaging Het
Kdm5d G A Y: 941,282 (GRCm39) R1161H probably damaging Het
Map4 T C 9: 109,897,648 (GRCm39) S675P probably benign Het
Mfsd4b3-ps A T 10: 39,823,222 (GRCm39) V346E probably damaging Het
Or1j21 A T 2: 36,683,601 (GRCm39) M118L probably damaging Het
Or2ad1 C T 13: 21,326,337 (GRCm39) V297I probably benign Het
Or7d11 T A 9: 19,966,757 (GRCm39) M1L probably benign Het
P2rx1 A C 11: 72,903,784 (GRCm39) K282T probably damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Ptprj A T 2: 90,274,758 (GRCm39) probably null Het
Pwp1 A G 10: 85,721,726 (GRCm39) I411V probably benign Het
Rnaset2b T C 17: 7,256,169 (GRCm39) S12P probably damaging Het
Rrs1 C A 1: 9,616,026 (GRCm39) probably null Het
Ryr2 T C 13: 11,774,589 (GRCm39) E1189G probably damaging Het
Slc25a21 T A 12: 56,785,272 (GRCm39) I202F probably benign Het
Tcfl5 A G 2: 180,264,440 (GRCm39) V472A probably benign Het
Ttc12 A T 9: 49,369,487 (GRCm39) probably benign Het
Ugt2b1 T G 5: 87,073,988 (GRCm39) I124L probably benign Het
Usp14 A T 18: 9,997,763 (GRCm39) N357K probably benign Het
Other mutations in Ctcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ctcf APN 8 106,403,968 (GRCm39) missense unknown
IGL01068:Ctcf APN 8 106,408,117 (GRCm39) unclassified probably benign
IGL01936:Ctcf APN 8 106,396,864 (GRCm39) missense probably benign 0.21
IGL02010:Ctcf APN 8 106,391,597 (GRCm39) missense probably damaging 1.00
IGL02545:Ctcf APN 8 106,391,013 (GRCm39) missense probably benign 0.39
IGL02617:Ctcf APN 8 106,403,842 (GRCm39) splice site probably benign
R0255:Ctcf UTSW 8 106,390,671 (GRCm39) missense possibly damaging 0.76
R0348:Ctcf UTSW 8 106,402,789 (GRCm39) nonsense probably null
R0497:Ctcf UTSW 8 106,401,672 (GRCm39) splice site probably benign
R1903:Ctcf UTSW 8 106,402,620 (GRCm39) splice site probably null
R2508:Ctcf UTSW 8 106,398,016 (GRCm39) missense probably damaging 1.00
R4035:Ctcf UTSW 8 106,390,789 (GRCm39) missense possibly damaging 0.52
R4448:Ctcf UTSW 8 106,406,925 (GRCm39) intron probably benign
R5106:Ctcf UTSW 8 106,408,130 (GRCm39) unclassified probably benign
R6370:Ctcf UTSW 8 106,390,852 (GRCm39) missense probably benign 0.05
R6378:Ctcf UTSW 8 106,390,423 (GRCm39) missense possibly damaging 0.70
R6392:Ctcf UTSW 8 106,390,765 (GRCm39) missense probably damaging 0.97
R6737:Ctcf UTSW 8 106,391,140 (GRCm39) missense probably benign 0.02
R7725:Ctcf UTSW 8 106,390,468 (GRCm39) missense probably damaging 1.00
R7791:Ctcf UTSW 8 106,391,571 (GRCm39) missense possibly damaging 0.47
R7895:Ctcf UTSW 8 106,390,690 (GRCm39) missense possibly damaging 0.95
R8396:Ctcf UTSW 8 106,393,379 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TAGGCAACAGGACAAGACCGTGCTTC -3'
(R):5'- TCGGGCTATGACAGTGTCACAATGGG -3'

Sequencing Primer
(F):5'- tggaaggcagaggcagg -3'
(R):5'- TGTCACAATGGGGACAATGAAATTTG -3'
Posted On 2014-01-29