Incidental Mutation 'R1238:P2rx1'
ID152506
Institutional Source Beutler Lab
Gene Symbol P2rx1
Ensembl Gene ENSMUSG00000020787
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 1
SynonymsP2X1 receptor, P2x, Pdcd3, RP-2
MMRRC Submission 039305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1238 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72999103-73015200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73012958 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 282 (K282T)
Ref Sequence ENSEMBL: ENSMUSP00000090614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021141] [ENSMUST00000092938]
Predicted Effect probably damaging
Transcript: ENSMUST00000021141
AA Change: K309T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021141
Gene: ENSMUSG00000020787
AA Change: K309T

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 376 1.2e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092938
AA Change: K282T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090614
Gene: ENSMUSG00000020787
AA Change: K282T

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 182 1.1e-71 PFAM
Pfam:P2X_receptor 171 355 2.1e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180695
Meta Mutation Damage Score 0.9328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit low male fertility due to impaired vas deferens contraction and reduced numbers of ejaculated sperm. Mutants also show mild hypertension and reduced susceptibility to experimental thromboembolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,597,639 probably benign Het
BC051665 T A 13: 60,784,637 N78I probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep290 A C 10: 100,517,863 Q819H probably damaging Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cit T A 5: 115,851,221 F56I probably benign Het
Colec10 T C 15: 54,462,439 F222L possibly damaging Het
Crocc G A 4: 141,035,364 A769V probably benign Het
Ctcf T C 8: 105,671,277 probably benign Het
Ect2l T C 10: 18,143,104 R607G possibly damaging Het
Efcab6 T G 15: 83,933,137 E745A probably benign Het
Eif1ad T G 19: 5,370,083 *171G probably null Het
Gm4759 A G 7: 106,423,057 V246A probably damaging Het
H2-D1 A G 17: 35,263,932 D146G probably damaging Het
Iqub C T 6: 24,505,885 R8H probably benign Het
Itih4 A T 14: 30,887,949 I79F probably damaging Het
Kdm5d G A Y: 941,282 R1161H probably damaging Het
Map4 T C 9: 110,068,580 S675P probably benign Het
Mfsd4b3 A T 10: 39,947,226 V346E probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr50 A T 2: 36,793,589 M118L probably damaging Het
Olfr867 T A 9: 20,055,461 M1L probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Ptprj A T 2: 90,444,414 probably null Het
Pwp1 A G 10: 85,885,862 I411V probably benign Het
Rnaset2b T C 17: 6,988,770 S12P probably damaging Het
Rrs1 C A 1: 9,545,801 probably null Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Slc25a21 T A 12: 56,738,487 I202F probably benign Het
Tcfl5 A G 2: 180,622,647 V472A probably benign Het
Ttc12 A T 9: 49,458,187 probably benign Het
Ugt2b1 T G 5: 86,926,129 I124L probably benign Het
Usp14 A T 18: 9,997,763 N357K probably benign Het
Other mutations in P2rx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:P2rx1 APN 11 73013000 critical splice donor site probably null
IGL01109:P2rx1 APN 11 73008215 missense probably damaging 0.99
IGL02466:P2rx1 APN 11 73009584 critical splice acceptor site probably null
IGL02524:P2rx1 APN 11 73009648 missense probably damaging 1.00
IGL02536:P2rx1 APN 11 73012474 missense probably damaging 1.00
PIT4382001:P2rx1 UTSW 11 73009200 missense probably benign 0.09
R0479:P2rx1 UTSW 11 73012961 missense probably damaging 1.00
R2156:P2rx1 UTSW 11 73014113 missense probably benign 0.15
R4016:P2rx1 UTSW 11 73009973 missense probably damaging 1.00
R5345:P2rx1 UTSW 11 73009230 missense probably damaging 1.00
R5440:P2rx1 UTSW 11 73008503 missense probably benign
R6172:P2rx1 UTSW 11 73010030 missense probably damaging 0.99
R6285:P2rx1 UTSW 11 73008148 missense probably benign 0.22
R6348:P2rx1 UTSW 11 72999322 missense probably benign
R7793:P2rx1 UTSW 11 73009253 nonsense probably null
Z1177:P2rx1 UTSW 11 73013899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCATTCTCCTTGAGCAATGCTG -3'
(R):5'- GGGAAAGTCAAACCTGCCTCCTAC -3'

Sequencing Primer
(F):5'- CTTGAGCAATGCTGGAGGG -3'
(R):5'- CAGGTCAGTAAACCTGAGCTTTG -3'
Posted On2014-01-29