Incidental Mutation 'R1238:Slc25a21'
ID152507
Institutional Source Beutler Lab
Gene Symbol Slc25a21
Ensembl Gene ENSMUSG00000035472
Gene Namesolute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms9930033G19Rik
MMRRC Submission 039305-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R1238 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location56712634-57197472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56738487 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 202 (I202F)
Ref Sequence ENSEMBL: ENSMUSP00000151751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044634] [ENSMUST00000110680] [ENSMUST00000217690]
Predicted Effect probably benign
Transcript: ENSMUST00000044634
AA Change: I195F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039289
Gene: ENSMUSG00000035472
AA Change: I195F

DomainStartEndE-ValueType
Pfam:Mito_carr 10 104 2.3e-24 PFAM
Pfam:Mito_carr 107 200 1.3e-16 PFAM
Pfam:Mito_carr 202 298 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110680
AA Change: I202F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106308
Gene: ENSMUSG00000035472
AA Change: I202F

DomainStartEndE-ValueType
Pfam:Mito_carr 28 111 4.7e-21 PFAM
Pfam:Mito_carr 114 207 7.7e-17 PFAM
Pfam:Mito_carr 209 305 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160709
Predicted Effect probably benign
Transcript: ENSMUST00000217690
AA Change: I202F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,597,639 probably benign Het
BC051665 T A 13: 60,784,637 N78I probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep290 A C 10: 100,517,863 Q819H probably damaging Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cit T A 5: 115,851,221 F56I probably benign Het
Colec10 T C 15: 54,462,439 F222L possibly damaging Het
Crocc G A 4: 141,035,364 A769V probably benign Het
Ctcf T C 8: 105,671,277 probably benign Het
Ect2l T C 10: 18,143,104 R607G possibly damaging Het
Efcab6 T G 15: 83,933,137 E745A probably benign Het
Eif1ad T G 19: 5,370,083 *171G probably null Het
Gm4759 A G 7: 106,423,057 V246A probably damaging Het
H2-D1 A G 17: 35,263,932 D146G probably damaging Het
Iqub C T 6: 24,505,885 R8H probably benign Het
Itih4 A T 14: 30,887,949 I79F probably damaging Het
Kdm5d G A Y: 941,282 R1161H probably damaging Het
Map4 T C 9: 110,068,580 S675P probably benign Het
Mfsd4b3 A T 10: 39,947,226 V346E probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr50 A T 2: 36,793,589 M118L probably damaging Het
Olfr867 T A 9: 20,055,461 M1L probably benign Het
P2rx1 A C 11: 73,012,958 K282T probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Ptprj A T 2: 90,444,414 probably null Het
Pwp1 A G 10: 85,885,862 I411V probably benign Het
Rnaset2b T C 17: 6,988,770 S12P probably damaging Het
Rrs1 C A 1: 9,545,801 probably null Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Tcfl5 A G 2: 180,622,647 V472A probably benign Het
Ttc12 A T 9: 49,458,187 probably benign Het
Ugt2b1 T G 5: 86,926,129 I124L probably benign Het
Usp14 A T 18: 9,997,763 N357K probably benign Het
Other mutations in Slc25a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc25a21 APN 12 56718137 splice site probably null
IGL00776:Slc25a21 APN 12 56770205 missense probably benign 0.43
IGL00788:Slc25a21 APN 12 56713812 utr 3 prime probably benign
IGL01396:Slc25a21 APN 12 57159189 missense probably benign
IGL01656:Slc25a21 APN 12 56738495 missense probably damaging 1.00
IGL03095:Slc25a21 APN 12 56738625 missense probably benign 0.09
R0285:Slc25a21 UTSW 12 56858025 critical splice donor site probably null
R1509:Slc25a21 UTSW 12 56858079 missense probably benign 0.00
R1803:Slc25a21 UTSW 12 56858087 missense probably benign 0.01
R3862:Slc25a21 UTSW 12 56718135 splice site probably benign
R4684:Slc25a21 UTSW 12 57196936 missense probably benign 0.00
R4816:Slc25a21 UTSW 12 56713838 missense probably damaging 1.00
R5718:Slc25a21 UTSW 12 56718156 missense probably benign 0.00
R6265:Slc25a21 UTSW 12 57196900 missense probably benign 0.33
R6953:Slc25a21 UTSW 12 57159169 missense probably benign
R7337:Slc25a21 UTSW 12 56858043 missense probably benign 0.03
U24488:Slc25a21 UTSW 12 56738497 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CAGCTTTTCTACTGACCTTCGGAAGTC -3'
(R):5'- TGGTCCCAAAATGATGTCTCTTGCTTG -3'

Sequencing Primer
(F):5'- CTCAGTTTCTGGATTTGAAAAGGAC -3'
(R):5'- CAAAATGATGTCTCTTGCTTGGTTTC -3'
Posted On2014-01-29