Mutagenetix > Incidental Mutations

Incidental Mutation 'V5622:Naip2'

152526

Institutional Source

Beutler Lab

Gene Symbol

Naip2

Ensembl Gene

ENSMUSG00000078945

Gene Name

NLR family, apoptosis inhibitory protein 2

Synonyms

Birc1b, Naip2, Naip-rs6

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

V5622 () of strain 521

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

100144063-100202092 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 100155029 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]

Predicted Effect

probably benign
Transcript: ENSMUST00000067975

SMART Domains

Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	1.9e-36	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117913

SMART Domains

Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	1.9e-36	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167986

SMART Domains

Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	8.6e-35	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221573

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 98.4%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 8 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	C	T	4: 147,941,776	S251F	probably benign	Het
Ccar2	G	T	14: 70,151,289	L158I	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Homo
Hspg2	C	A	4: 137,533,738	Q1648K	probably damaging	Het
Hvcn1	TGAGGAGGAGGAGGAGGAG	TGAGGAGGAGGAGGAG	5: 122,233,539		probably benign	Het
Megf11	C	A	9: 64,690,069	C674*	probably null	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zbtb12	C	A	17: 34,896,301	A354E	possibly damaging	Het

Other mutations in Naip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Naip2	APN	13	100154887	missense	probably benign	0.00
IGL00676:Naip2	APN	13	100152632	missense	probably damaging	1.00
IGL00870:Naip2	APN	13	100152060	splice site	probably benign
IGL00908:Naip2	APN	13	100160649	missense	probably benign	0.01
IGL00916:Naip2	APN	13	100161431	missense	probably damaging	0.97
IGL00949:Naip2	APN	13	100161591	missense	probably damaging	1.00
IGL01010:Naip2	APN	13	100154938	missense	probably damaging	0.99
IGL01642:Naip2	APN	13	100160937	missense	probably damaging	0.97
IGL01884:Naip2	APN	13	100188821	splice site	probably benign
IGL01917:Naip2	APN	13	100162083	missense	probably benign	0.00
IGL02015:Naip2	APN	13	100161607	missense	possibly damaging	0.57
IGL02315:Naip2	APN	13	100161236	missense	probably damaging	1.00
IGL02328:Naip2	APN	13	100161369	missense	probably damaging	1.00
IGL02735:Naip2	APN	13	100160214	missense	probably damaging	0.99
IGL02738:Naip2	APN	13	100189177	missense	probably benign	0.01
IGL02887:Naip2	APN	13	100161512	missense	possibly damaging	0.90
IGL02894:Naip2	APN	13	100160997	missense	probably damaging	1.00
IGL02894:Naip2	APN	13	100183789	missense	probably benign
IGL02974:Naip2	APN	13	100161678	missense	probably damaging	1.00
IGL03024:Naip2	APN	13	100189354	missense	possibly damaging	0.50
IGL03056:Naip2	APN	13	100162287	missense	possibly damaging	0.90
IGL03281:Naip2	APN	13	100161620	missense	probably damaging	0.99
R0131:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0131:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0132:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0310:Naip2	UTSW	13	100148842	missense	probably damaging	1.00
R0367:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0368:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0422:Naip2	UTSW	13	100161113	missense	probably benign	0.10
R0441:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0445:Naip2	UTSW	13	100161887	missense	possibly damaging	0.91
R0446:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0464:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0466:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0467:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0486:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0533:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0853:Naip2	UTSW	13	100161854	missense	probably benign
R0853:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0855:Naip2	UTSW	13	100161854	missense	probably benign
R0855:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0904:Naip2	UTSW	13	100161854	missense	probably benign
R0904:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0906:Naip2	UTSW	13	100161854	missense	probably benign
R0906:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0908:Naip2	UTSW	13	100161854	missense	probably benign
R0908:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0959:Naip2	UTSW	13	100154878	missense	probably benign	0.01
R0959:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R0962:Naip2	UTSW	13	100179385	missense	probably damaging	1.00
R1024:Naip2	UTSW	13	100161854	missense	probably benign
R1024:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1186:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1186:Naip2	UTSW	13	100162037	frame shift	probably null
R1217:Naip2	UTSW	13	100161854	missense	probably benign
R1217:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1340:Naip2	UTSW	13	100189122	missense	possibly damaging	0.80
R1342:Naip2	UTSW	13	100161854	missense	probably benign
R1342:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1404:Naip2	UTSW	13	100161854	missense	probably benign
R1423:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1423:Naip2	UTSW	13	100154847	intron	probably benign
R1423:Naip2	UTSW	13	100154872	missense	possibly damaging	0.59
R1423:Naip2	UTSW	13	100154878	missense	probably benign	0.01
R1426:Naip2	UTSW	13	100161854	missense	probably benign
R1426:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1472:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1575:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R1575:Naip2	UTSW	13	100155029	intron	probably benign
R1576:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R1576:Naip2	UTSW	13	100155029	intron	probably benign
R1599:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1640:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1641:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1642:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1643:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1644:Naip2	UTSW	13	100182929	missense	possibly damaging	0.83
R1681:Naip2	UTSW	13	100161854	missense	probably benign
R1681:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1891:Naip2	UTSW	13	100154887	missense	probably benign	0.00
R1913:Naip2	UTSW	13	100152157	critical splice acceptor site	probably null
R1937:Naip2	UTSW	13	100161854	missense	probably benign
R1937:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1993:Naip2	UTSW	13	100162007	missense	probably benign	0.03
R2001:Naip2	UTSW	13	100144588	missense	probably damaging	1.00
R2055:Naip2	UTSW	13	100179372	missense	probably benign	0.07
R2198:Naip2	UTSW	13	100152592	missense	probably damaging	1.00
R2906:Naip2	UTSW	13	100161996	missense	probably damaging	1.00
R2931:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R3014:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R3016:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R3037:Naip2	UTSW	13	100154949	missense	probably benign	0.08
R3414:Naip2	UTSW	13	100189263	nonsense	probably null
R3437:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R3713:Naip2	UTSW	13	100161902	missense	probably damaging	1.00
R3806:Naip2	UTSW	13	100152634	missense	possibly damaging	0.92
R3847:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3847:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3848:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3848:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3849:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3849:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3850:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3850:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3891:Naip2	UTSW	13	100161098	missense	probably damaging	0.99
R4419:Naip2	UTSW	13	100160625	missense	probably benign	0.03
R4456:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R4458:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R4689:Naip2	UTSW	13	100148812	missense	probably damaging	1.00
R4797:Naip2	UTSW	13	100161735	missense	probably damaging	1.00
R4852:Naip2	UTSW	13	100161536	missense	probably benign
R4922:Naip2	UTSW	13	100154960	missense	probably benign
R5135:Naip2	UTSW	13	100179440	missense	probably damaging	0.98
R5185:Naip2	UTSW	13	100189351	missense	probably damaging	1.00
R5265:Naip2	UTSW	13	100152560	missense	probably damaging	1.00
R5451:Naip2	UTSW	13	100188860	missense	probably benign	0.12
R5521:Naip2	UTSW	13	100154914	missense	probably damaging	1.00
R5737:Naip2	UTSW	13	100161854	missense	probably benign	0.38
R6244:Naip2	UTSW	13	100152137	missense	probably damaging	1.00
R6478:Naip2	UTSW	13	100162041	missense	probably benign
R6480:Naip2	UTSW	13	100162041	missense	probably benign
R6481:Naip2	UTSW	13	100162041	missense	probably benign
R6490:Naip2	UTSW	13	100160685	missense	probably benign
R6653:Naip2	UTSW	13	100152136	missense	probably benign	0.00
R6653:Naip2	UTSW	13	100161844	missense	probably benign
R6768:Naip2	UTSW	13	100178324	nonsense	probably null
R6791:Naip2	UTSW	13	100154960	missense	probably benign
R6793:Naip2	UTSW	13	100154960	missense	probably benign
R6890:Naip2	UTSW	13	100162041	missense	probably benign
R7036:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R7213:Naip2	UTSW	13	100187483	missense	probably damaging	1.00
R7342:Naip2	UTSW	13	100189356	missense	probably benign	0.09
R7445:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R7572:Naip2	UTSW	13	100154960	missense	probably benign
R7742:Naip2	UTSW	13	100154887	missense	probably benign	0.00
V5622:Naip2	UTSW	13	100155021	missense	probably benign	0.00
V5622:Naip2	UTSW	13	100155021	missense	probably benign	0.00
X0063:Naip2	UTSW	13	100161758	missense	probably damaging	1.00
Y5405:Naip2	UTSW	13	100154960	missense	probably benign
Z1088:Naip2	UTSW	13	100161909	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGAGATCAAGCACCATCCCTTACC -3'
(R):5'- TGTGAGTCTAGAGTCCAGCACAGG -3'

Sequencing Primer
(F):5'- TACCTAGTTTGGAGAGGTCAGACTC -3'
(R):5'- ACAGGGCTTGCCCTAGAG -3'

Posted On

2014-01-29