Incidental Mutation 'V5622:Ccar2'
ID152527
Institutional Source Beutler Lab
Gene Symbol Ccar2
Ensembl Gene ENSMUSG00000033712
Gene Namecell cycle activator and apoptosis regulator 2
Synonyms2610301G19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #V5622 () of strain 521
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70138164-70153811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70151289 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 158 (L158I)
Ref Sequence ENSEMBL: ENSMUSP00000036924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035612] [ENSMUST00000058240] [ENSMUST00000129767] [ENSMUST00000153871]
Predicted Effect probably damaging
Transcript: ENSMUST00000035612
AA Change: L158I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712
AA Change: L158I

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058240
SMART Domains Protein: ENSMUSP00000061834
Gene: ENSMUSG00000044551

DomainStartEndE-ValueType
Pfam:DUF4657 78 366 1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140314
Predicted Effect probably benign
Transcript: ENSMUST00000153871
SMART Domains Protein: ENSMUSP00000122309
Gene: ENSMUSG00000044551

DomainStartEndE-ValueType
Pfam:DUF4657 78 365 1.4e-132 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice on a high fat diet are resistant to hepatic steatosis and associated liver inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,941,776 S251F probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Homo
Hspg2 C A 4: 137,533,738 Q1648K probably damaging Het
Hvcn1 TGAGGAGGAGGAGGAGGAG TGAGGAGGAGGAGGAG 5: 122,233,539 probably benign Het
Megf11 C A 9: 64,690,069 C674* probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Other mutations in Ccar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccar2 APN 14 70142531 nonsense probably null
IGL01351:Ccar2 APN 14 70145862 missense probably benign 0.03
IGL01450:Ccar2 APN 14 70139751 splice site probably benign
IGL02306:Ccar2 APN 14 70142022 missense probably benign 0.01
IGL03403:Ccar2 APN 14 70140068 missense probably damaging 1.00
R0332:Ccar2 UTSW 14 70141935 splice site probably benign
R0502:Ccar2 UTSW 14 70140982 missense probably benign 0.00
R0827:Ccar2 UTSW 14 70139838 missense probably benign 0.00
R1022:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1024:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1160:Ccar2 UTSW 14 70139769 missense probably benign 0.42
R1258:Ccar2 UTSW 14 70152673 missense probably benign 0.24
R1389:Ccar2 UTSW 14 70140109 missense possibly damaging 0.46
R1532:Ccar2 UTSW 14 70142956 missense probably benign 0.01
R1870:Ccar2 UTSW 14 70140497 missense probably damaging 1.00
R2127:Ccar2 UTSW 14 70139651 missense probably benign 0.33
R4233:Ccar2 UTSW 14 70151091 missense possibly damaging 0.76
R4569:Ccar2 UTSW 14 70151910 unclassified probably null
R4799:Ccar2 UTSW 14 70139554 missense probably damaging 0.99
R5026:Ccar2 UTSW 14 70142502 missense possibly damaging 0.89
R5435:Ccar2 UTSW 14 70139327 missense probably damaging 1.00
R5893:Ccar2 UTSW 14 70151351 missense probably benign 0.28
R6446:Ccar2 UTSW 14 70143069 missense probably benign 0.31
R6594:Ccar2 UTSW 14 70140476 missense probably damaging 1.00
R6648:Ccar2 UTSW 14 70139225 missense probably benign 0.29
R7103:Ccar2 UTSW 14 70141977 missense probably damaging 0.99
R7594:Ccar2 UTSW 14 70141794 nonsense probably null
R7679:Ccar2 UTSW 14 70139235 nonsense probably null
V5088:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
V5622:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATGGCCGGTGACTCAAAAGCCC -3'
(R):5'- AATGCTGTCAAGGTGCAGACGCTC -3'

Sequencing Primer
(F):5'- GGTGACTCAAAAGCCCTAAAAC -3'
(R):5'- AGCATGTCCTCTGCAATGG -3'
Posted On2014-01-29