Incidental Mutation 'V7581:Erv3'
ID 152535
Institutional Source Beutler Lab
Gene Symbol Erv3
Ensembl Gene ENSMUSG00000037482
Gene Name endogenous retroviral sequence 3
Synonyms 1600014E20Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # V7581 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 131695598-131701667 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131697846 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 171 (H171R)
Ref Sequence ENSEMBL: ENSMUSP00000047030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040941]
AlphaFold Q9DAX3
Predicted Effect possibly damaging
Transcript: ENSMUST00000040941
AA Change: H171R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047030
Gene: ENSMUSG00000037482
AA Change: H171R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,050 (GRCm39) H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 124,696,500 (GRCm39) probably benign Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Clasp1 G A 1: 118,509,078 (GRCm39) R1027Q probably damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Dpyd C T 3: 118,690,775 (GRCm39) Q295* probably null Het
Dync2i1 A C 12: 116,175,460 (GRCm39) S906A possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Fcgr1 T C 3: 96,191,592 (GRCm39) *405W probably null Het
Glrx3 A G 7: 137,060,882 (GRCm39) H172R probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Hira G A 16: 18,713,571 (GRCm39) A29T probably damaging Het
Hnrnpab A T 11: 51,493,451 (GRCm39) N252K probably benign Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Muc6 T G 7: 141,233,880 (GRCm39) E808A probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5p57 G T 7: 107,665,885 (GRCm39) T40K probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Prkcb G T 7: 122,127,699 (GRCm39) W274C probably damaging Het
Rbbp8nl T A 2: 179,920,001 (GRCm39) T558S probably benign Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Slc5a6 C T 5: 31,199,957 (GRCm39) probably null Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Tmc3 T C 7: 83,271,713 (GRCm39) V955A probably benign Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Toe1 A T 4: 116,663,308 (GRCm39) N56K probably damaging Het
Tprkb A G 6: 85,905,764 (GRCm39) K150E probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Vmn2r68 C T 7: 84,871,088 (GRCm39) V732I probably benign Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zfp933 G A 4: 147,910,927 (GRCm39) A223V probably damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Erv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Erv3 APN 2 131,697,877 (GRCm39) nonsense probably null
IGL02034:Erv3 APN 2 131,697,934 (GRCm39) missense possibly damaging 0.46
F5770:Erv3 UTSW 2 131,697,846 (GRCm39) missense possibly damaging 0.66
R1518:Erv3 UTSW 2 131,698,083 (GRCm39) missense probably benign 0.04
R6036:Erv3 UTSW 2 131,697,925 (GRCm39) missense possibly damaging 0.46
R6036:Erv3 UTSW 2 131,697,925 (GRCm39) missense possibly damaging 0.46
R6045:Erv3 UTSW 2 131,697,942 (GRCm39) missense probably damaging 0.97
R6988:Erv3 UTSW 2 131,697,886 (GRCm39) missense possibly damaging 0.90
R8552:Erv3 UTSW 2 131,698,261 (GRCm39) missense possibly damaging 0.66
R8934:Erv3 UTSW 2 131,698,101 (GRCm39) missense probably benign
R9295:Erv3 UTSW 2 131,697,979 (GRCm39) missense possibly damaging 0.66
R9495:Erv3 UTSW 2 131,697,975 (GRCm39) missense possibly damaging 0.82
V7580:Erv3 UTSW 2 131,697,846 (GRCm39) missense possibly damaging 0.66
V7582:Erv3 UTSW 2 131,697,846 (GRCm39) missense possibly damaging 0.66
V7583:Erv3 UTSW 2 131,697,846 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTTCAGGACCAACGATCAGGCATAG -3'
(R):5'- TCCACACTGGGGCTGCAAATATC -3'

Sequencing Primer
(F):5'- TTAGCAACTCAAAGGCGGTC -3'
(R):5'- ATCATAGTACTTGGCCCAGATGG -3'
Posted On 2014-01-29