Incidental Mutation 'V7581:Rbbp8nl'
ID 152541
Institutional Source Beutler Lab
Gene Symbol Rbbp8nl
Ensembl Gene ENSMUSG00000038980
Gene Name RBBP8 N-terminal like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # V7581 () of strain stinger
Quality Score 220
Status Not validated
Chromosome 2
Chromosomal Location 180277646-180289879 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 180278208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 558 (T558S)
Ref Sequence ENSEMBL: ENSMUSP00000047237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038529] [ENSMUST00000108891]
AlphaFold A2ABX0
Predicted Effect probably benign
Transcript: ENSMUST00000038529
AA Change: T558S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047237
Gene: ENSMUSG00000038980
AA Change: T558S

DomainStartEndE-ValueType
Pfam:CtIP_N 4 123 5.6e-56 PFAM
low complexity region 143 154 N/A INTRINSIC
low complexity region 157 172 N/A INTRINSIC
low complexity region 237 250 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
low complexity region 352 361 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 585 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108891
SMART Domains Protein: ENSMUSP00000104519
Gene: ENSMUSG00000038990

DomainStartEndE-ValueType
low complexity region 2 39 N/A INTRINSIC
low complexity region 58 102 N/A INTRINSIC
low complexity region 116 121 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
CYCLIN 365 452 1.55e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136706
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 123,969,761 probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Rbbp8nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rbbp8nl APN 2 180279695 missense probably benign 0.01
IGL01845:Rbbp8nl APN 2 180283311 missense probably damaging 0.99
IGL01966:Rbbp8nl APN 2 180280989 splice site probably benign
IGL02217:Rbbp8nl APN 2 180278188 unclassified probably benign
IGL02500:Rbbp8nl APN 2 180279329 missense possibly damaging 0.57
IGL02623:Rbbp8nl APN 2 180281443 missense probably damaging 0.99
IGL02634:Rbbp8nl APN 2 180280895 missense probably benign 0.00
F5770:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
R0380:Rbbp8nl UTSW 2 180281719 missense probably damaging 0.96
R1773:Rbbp8nl UTSW 2 180281194 missense probably benign 0.00
R1858:Rbbp8nl UTSW 2 180282213 splice site probably benign
R1901:Rbbp8nl UTSW 2 180283313 missense probably damaging 1.00
R1962:Rbbp8nl UTSW 2 180280874 missense probably benign 0.03
R2423:Rbbp8nl UTSW 2 180280971 missense probably damaging 0.98
R2495:Rbbp8nl UTSW 2 180279102 missense probably null 0.31
R3738:Rbbp8nl UTSW 2 180281248 missense probably benign 0.37
R4460:Rbbp8nl UTSW 2 180280971 missense probably benign 0.41
R4502:Rbbp8nl UTSW 2 180279196 missense possibly damaging 0.48
R5573:Rbbp8nl UTSW 2 180279793 missense possibly damaging 0.95
R5699:Rbbp8nl UTSW 2 180278668 missense probably damaging 0.98
R6242:Rbbp8nl UTSW 2 180280974 missense probably damaging 1.00
R6269:Rbbp8nl UTSW 2 180281512 nonsense probably null
R6586:Rbbp8nl UTSW 2 180280959 missense probably damaging 1.00
R6875:Rbbp8nl UTSW 2 180279226 missense probably benign 0.00
R8055:Rbbp8nl UTSW 2 180278208 missense probably benign 0.00
R8344:Rbbp8nl UTSW 2 180279713 missense probably benign 0.18
R8944:Rbbp8nl UTSW 2 180277976 nonsense probably null
R9279:Rbbp8nl UTSW 2 180279101 critical splice donor site probably null
R9352:Rbbp8nl UTSW 2 180279260 missense probably benign 0.00
V7582:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTATCAGGCTCCAACTGGAACCC -3'
(R):5'- AGCCCCTCTATGTCCTCATCTGAAG -3'

Sequencing Primer
(F):5'- GGAACCCAGATGCTATTCTCCAG -3'
(R):5'- GTCCTCATCTGAAGAGTCATTATTC -3'
Posted On 2014-01-29