Incidental Mutation 'V7581:Fcgr1'
ID 152542
Institutional Source Beutler Lab
Gene Symbol Fcgr1
Ensembl Gene ENSMUSG00000015947
Gene Name Fc receptor, IgG, high affinity I
Synonyms CD64, FcgammaRI
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.254) question?
Stock # V7581 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 96282909-96293969 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 96284276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 405 (*405W)
Ref Sequence ENSEMBL: ENSMUSP00000029748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029748]
AlphaFold P26151
Predicted Effect probably null
Transcript: ENSMUST00000029748
AA Change: *405W
SMART Domains Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: *405W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 111 1.8e-5 SMART
IGc2 125 184 6.11e-8 SMART
IG 206 290 7.3e-6 SMART
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200420
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 (GRCm38) H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 123,969,761 (GRCm38) probably benign Het
Atp6v1h A G 1: 5,124,443 (GRCm38) T282A possibly damaging Het
Clasp1 G A 1: 118,581,348 (GRCm38) R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 (GRCm38) T870A probably benign Het
Dnah12 T A 14: 26,773,093 (GRCm38) N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 (GRCm38) Y183N probably damaging Het
Dpyd C T 3: 118,897,126 (GRCm38) Q295* probably null Het
Erv3 T C 2: 131,855,926 (GRCm38) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm38) T249A probably benign Het
Glrx3 A G 7: 137,459,153 (GRCm38) H172R probably benign Het
Gm10770 T A 2: 150,179,484 (GRCm38) K38* probably null Het
Gm4787 G A 12: 81,377,567 (GRCm38) Q606* probably null Het
Hira G A 16: 18,894,821 (GRCm38) A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 (GRCm38) N252K probably benign Het
Izumo4 A T 10: 80,703,891 (GRCm38) T155S probably benign Het
Kcnb2 A G 1: 15,710,091 (GRCm38) I396V probably benign Het
Klc1 A T 12: 111,774,572 (GRCm38) I161F probably benign Het
Lpar5 C A 6: 125,081,727 (GRCm38) A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 (GRCm38) S900L possibly damaging Het
Muc6 T G 7: 141,647,613 (GRCm38) E808A probably benign Het
Or10j7 G T 1: 173,183,964 (GRCm38) L157I probably benign Het
Or5p57 G T 7: 108,066,678 (GRCm38) T40K probably benign Het
Otop3 T A 11: 115,344,838 (GRCm38) L432Q probably damaging Het
Papln C T 12: 83,778,834 (GRCm38) R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 (GRCm38) T257S probably damaging Het
Pik3cd A C 4: 149,657,319 (GRCm38) L390R probably damaging Het
Ppwd1 A G 13: 104,220,237 (GRCm38) Y257H probably damaging Het
Prkcb G T 7: 122,528,476 (GRCm38) W274C probably damaging Het
Rbbp8nl T A 2: 180,278,208 (GRCm38) T558S probably benign Het
Recql4 T C 15: 76,706,169 (GRCm38) D705G possibly damaging Het
Slc30a4 T A 2: 122,689,538 (GRCm38) M136L probably benign Het
Slc5a6 C T 5: 31,042,613 (GRCm38) probably null Het
Spaca1 T C 4: 34,039,311 (GRCm38) E192G probably damaging Het
Spata31 C A 13: 64,921,648 (GRCm38) P537T probably benign Het
Tmc3 T C 7: 83,622,505 (GRCm38) V955A probably benign Het
Tnrc6c G A 11: 117,723,326 (GRCm38) R770H probably damaging Het
Toe1 A T 4: 116,806,111 (GRCm38) N56K probably damaging Het
Tprkb A G 6: 85,928,782 (GRCm38) K150E probably damaging Het
Trps1 T C 15: 50,831,577 (GRCm38) K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 (GRCm38) V86A probably benign Het
Vmn2r68 C T 7: 85,221,880 (GRCm38) V732I probably benign Het
Wdr60 A C 12: 116,211,840 (GRCm38) S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 (GRCm38) C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 (GRCm38) A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 (GRCm38) R724* probably null Het
Other mutations in Fcgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Fcgr1 APN 3 96,284,370 (GRCm38) missense probably benign 0.01
IGL02142:Fcgr1 APN 3 96,284,577 (GRCm38) missense probably benign 0.41
IGL03086:Fcgr1 APN 3 96,284,498 (GRCm38) nonsense probably null
F5770:Fcgr1 UTSW 3 96,284,276 (GRCm38) makesense probably null
FR4737:Fcgr1 UTSW 3 96,287,094 (GRCm38) missense probably benign 0.01
FR4737:Fcgr1 UTSW 3 96,284,504 (GRCm38) frame shift probably null
R0323:Fcgr1 UTSW 3 96,285,829 (GRCm38) missense possibly damaging 0.84
R0594:Fcgr1 UTSW 3 96,292,312 (GRCm38) missense probably damaging 1.00
R0926:Fcgr1 UTSW 3 96,292,366 (GRCm38) missense possibly damaging 0.79
R1951:Fcgr1 UTSW 3 96,287,070 (GRCm38) missense probably damaging 1.00
R1953:Fcgr1 UTSW 3 96,287,070 (GRCm38) missense probably damaging 1.00
R1993:Fcgr1 UTSW 3 96,285,868 (GRCm38) missense probably damaging 0.98
R2255:Fcgr1 UTSW 3 96,285,917 (GRCm38) missense possibly damaging 0.88
R3941:Fcgr1 UTSW 3 96,286,033 (GRCm38) missense probably benign 0.13
R4004:Fcgr1 UTSW 3 96,284,352 (GRCm38) missense probably benign 0.00
R4409:Fcgr1 UTSW 3 96,284,577 (GRCm38) missense probably benign 0.41
R5046:Fcgr1 UTSW 3 96,286,986 (GRCm38) missense probably damaging 0.99
R5047:Fcgr1 UTSW 3 96,285,884 (GRCm38) missense probably benign 0.38
R6970:Fcgr1 UTSW 3 96,284,620 (GRCm38) critical splice acceptor site probably null
R7339:Fcgr1 UTSW 3 96,284,299 (GRCm38) missense not run
R7992:Fcgr1 UTSW 3 96,284,581 (GRCm38) missense probably benign 0.23
R8554:Fcgr1 UTSW 3 96,292,472 (GRCm38) missense probably damaging 1.00
R9269:Fcgr1 UTSW 3 96,285,838 (GRCm38) missense probably benign 0.01
R9396:Fcgr1 UTSW 3 96,287,074 (GRCm38) nonsense probably null
V7582:Fcgr1 UTSW 3 96,284,276 (GRCm38) makesense probably null
V7583:Fcgr1 UTSW 3 96,284,276 (GRCm38) makesense probably null
X0028:Fcgr1 UTSW 3 96,286,027 (GRCm38) missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTCCGATGCTCTCAGGATGACCAC -3'
(R):5'- CTTTCAGCAAGTTAGAAGCGATGGC -3'

Sequencing Primer
(F):5'- TCTCAGACTGGAGTCTTCCAGAG -3'
(R):5'- CGTGTATGAAGAAGTAACAGCCAC -3'
Posted On 2014-01-29