Incidental Mutation 'V7581:9530002B09Rik'
ID 152548
Institutional Source Beutler Lab
Gene Symbol 9530002B09Rik
Ensembl Gene ENSMUSG00000023263
Gene Name RIKEN cDNA 9530002B09 gene
Synonyms Aump, Vpp1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # V7581 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 122689275-122705129 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122701257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 102 (H102L)
Ref Sequence ENSEMBL: ENSMUSP00000024032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024032]
AlphaFold Q9EPV7
Predicted Effect possibly damaging
Transcript: ENSMUST00000024032
AA Change: H102L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024032
Gene: ENSMUSG00000023263
AA Change: H102L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Palm_thioest 37 129 1.9e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 GGCCATCG GG 8: 123,969,761 probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in 9530002B09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02824:9530002B09Rik APN 4 122702319 splice site probably benign
F5770:9530002B09Rik UTSW 4 122701257 missense possibly damaging 0.71
R0391:9530002B09Rik UTSW 4 122701177 splice site probably benign
R0553:9530002B09Rik UTSW 4 122702335 missense unknown
R2063:9530002B09Rik UTSW 4 122689322 start gained probably benign
R2064:9530002B09Rik UTSW 4 122689322 start gained probably benign
R2065:9530002B09Rik UTSW 4 122689322 start gained probably benign
R2066:9530002B09Rik UTSW 4 122689322 start gained probably benign
R2067:9530002B09Rik UTSW 4 122689322 start gained probably benign
R2095:9530002B09Rik UTSW 4 122702358 nonsense probably null
R2146:9530002B09Rik UTSW 4 122689405 nonsense probably null
R4584:9530002B09Rik UTSW 4 122701186 missense possibly damaging 0.84
R4965:9530002B09Rik UTSW 4 122700492 missense probably benign 0.05
R8844:9530002B09Rik UTSW 4 122701218 missense possibly damaging 0.71
V7582:9530002B09Rik UTSW 4 122701257 missense possibly damaging 0.71
V7583:9530002B09Rik UTSW 4 122701257 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCAAACCTTCTCCACATTGACTTGTACT -3'
(R):5'- TCCACAAAGCTTCTTACTGGCACATT -3'

Sequencing Primer
(F):5'- aggagaaggaaggtgagagg -3'
(R):5'- ACTGGCACATTTTAAAACTGATTTC -3'
Posted On 2014-01-29