Incidental Mutation 'V7581:Slc5a6'
ID 152551
Institutional Source Beutler Lab
Gene Symbol Slc5a6
Ensembl Gene ENSMUSG00000006641
Gene Name solute carrier family 5 (sodium-dependent vitamin transporter), member 6
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # V7581 () of strain stinger
Quality Score 142
Status Not validated
Chromosome 5
Chromosomal Location 31036036-31048924 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 31042613 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080431] [ENSMUST00000114668] [ENSMUST00000200816] [ENSMUST00000202520] [ENSMUST00000202556] [ENSMUST00000202984] [ENSMUST00000202984]
AlphaFold Q5U4D8
Predicted Effect probably damaging
Transcript: ENSMUST00000080431
AA Change: R141Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079291
Gene: ENSMUSG00000006641
AA Change: R141Q

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114668
AA Change: R141Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110316
Gene: ENSMUSG00000006641
AA Change: R141Q

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200816
SMART Domains Protein: ENSMUSP00000144665
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201017
Predicted Effect probably damaging
Transcript: ENSMUST00000202520
AA Change: R141Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143938
Gene: ENSMUSG00000006641
AA Change: R141Q

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202556
AA Change: R141Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143993
Gene: ENSMUSG00000006641
AA Change: R141Q

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202984
SMART Domains Protein: ENSMUSP00000144349
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
Pfam:SSF 2 104 6.3e-15 PFAM
transmembrane domain 158 180 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202984
SMART Domains Protein: ENSMUSP00000144349
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
Pfam:SSF 2 104 6.3e-15 PFAM
transmembrane domain 158 180 N/A INTRINSIC
Meta Mutation Damage Score 0.8981 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 123,969,761 probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Slc5a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Slc5a6 APN 5 31038935 unclassified probably benign
IGL02305:Slc5a6 APN 5 31037835 missense probably benign 0.01
IGL02457:Slc5a6 APN 5 31040658 missense probably damaging 1.00
IGL02691:Slc5a6 APN 5 31042174 missense probably damaging 0.99
IGL02737:Slc5a6 APN 5 31037167 missense probably benign 0.01
IGL03277:Slc5a6 APN 5 31038028 missense possibly damaging 0.90
IGL03389:Slc5a6 APN 5 31037477 missense probably damaging 1.00
Burke UTSW 5 31036884 nonsense probably null
whig UTSW 5 31036811 missense probably damaging 1.00
F5770:Slc5a6 UTSW 5 31042613 splice site probably null
R1177:Slc5a6 UTSW 5 31039302 critical splice donor site probably null
R1505:Slc5a6 UTSW 5 31037111 missense probably benign 0.00
R1680:Slc5a6 UTSW 5 31042644 missense probably damaging 1.00
R1800:Slc5a6 UTSW 5 31040676 nonsense probably null
R1881:Slc5a6 UTSW 5 31036811 missense probably damaging 1.00
R2216:Slc5a6 UTSW 5 31039335 missense possibly damaging 0.77
R3803:Slc5a6 UTSW 5 31042951 missense probably damaging 1.00
R4250:Slc5a6 UTSW 5 31037718 missense probably benign 0.00
R4765:Slc5a6 UTSW 5 31038083 missense possibly damaging 0.85
R4821:Slc5a6 UTSW 5 31036884 nonsense probably null
R5187:Slc5a6 UTSW 5 31042978 missense probably damaging 1.00
R5536:Slc5a6 UTSW 5 31043102 missense probably damaging 1.00
R5554:Slc5a6 UTSW 5 31038100 missense probably damaging 0.98
R5806:Slc5a6 UTSW 5 31040770 missense probably damaging 1.00
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6615:Slc5a6 UTSW 5 31036830 missense probably benign
R6621:Slc5a6 UTSW 5 31040778 missense probably damaging 0.98
R6983:Slc5a6 UTSW 5 31040405 missense probably benign
R7989:Slc5a6 UTSW 5 31042136 critical splice donor site probably null
R8433:Slc5a6 UTSW 5 31037462 missense possibly damaging 0.54
R9180:Slc5a6 UTSW 5 31037846 missense probably damaging 0.97
R9390:Slc5a6 UTSW 5 31040459 missense possibly damaging 0.65
X0022:Slc5a6 UTSW 5 31043338 start codon destroyed probably null 0.97
Z1176:Slc5a6 UTSW 5 31038025 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGCAGGTGGAAAGACAGCATCCC -3'
(R):5'- TGAGCAGAACAGGATGACTTCCCAG -3'

Sequencing Primer
(F):5'- cagagctgaggaccgaac -3'
(R):5'- TGACTTCCCAGTACAGGGATG -3'
Posted On 2014-01-29