Mutagenetix > Incidental Mutations

Incidental Mutation 'V7581:Lpar5'

152553

Institutional Source

Beutler Lab

Gene Symbol

Lpar5

Ensembl Gene

ENSMUSG00000067714

Gene Name

lysophosphatidic acid receptor 5

Synonyms

LPA5, LOC381810, Gpr92, GPR93

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

V7581 () of strain stinger

Quality Score

106

Status

Not validated

Chromosome

Chromosomal Location

125067920-125082472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 125081727 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 137 (A137E)

Ref Sequence

ENSEMBL: ENSMUSP00000119904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088292
AA Change: A137E

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714
AA Change: A137E

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:7tm_1	55	313	7.4e-40	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140346
AA Change: A137E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714
AA Change: A137E

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:7tm_1	55	164	1.5e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171989
AA Change: A137E

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714
AA Change: A137E

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:7tm_1	55	313	1.1e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203956

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Abcb10	GGCCATCG	GG	8: 123,969,761		probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Clasp1	G	A	1: 118,581,348	R1027Q	probably damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Glrx3	A	G	7: 137,459,153	H172R	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Hira	G	A	16: 18,894,821	A29T	probably damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr480	G	T	7: 108,066,678	T40K	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Prkcb	G	T	7: 122,528,476	W274C	probably damaging	Het
Rbbp8nl	T	A	2: 180,278,208	T558S	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Slc5a6	C	T	5: 31,042,613		probably null	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tmc3	T	C	7: 83,622,505	V955A	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vmn2r68	C	T	7: 85,221,880	V732I	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Lpar5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Lpar5	APN	6	125082006	missense	possibly damaging	0.94
IGL01830:Lpar5	APN	6	125081822	missense	probably benign	0.01
IGL01975:Lpar5	APN	6	125081787	missense	probably damaging	0.99
IGL02021:Lpar5	APN	6	125081992	nonsense	probably null
IGL02718:Lpar5	APN	6	125082244	missense	probably damaging	1.00
IGL03027:Lpar5	APN	6	125082240	missense	probably damaging	1.00
IGL03300:Lpar5	APN	6	125082240	missense	probably damaging	1.00
F5770:Lpar5	UTSW	6	125081727	missense	possibly damaging	0.88
R0633:Lpar5	UTSW	6	125081991	missense	probably benign	0.25
R1639:Lpar5	UTSW	6	125081601	missense	probably damaging	1.00
R1822:Lpar5	UTSW	6	125081415	missense	possibly damaging	0.76
R2227:Lpar5	UTSW	6	125081135	critical splice acceptor site	probably null
R4019:Lpar5	UTSW	6	125081675	missense	probably damaging	1.00
R4288:Lpar5	UTSW	6	125081864	missense	probably benign	0.00
R4705:Lpar5	UTSW	6	125082207	missense	possibly damaging	0.64
R4787:Lpar5	UTSW	6	125082498	splice site	probably null
R5027:Lpar5	UTSW	6	125082147	missense	possibly damaging	0.69
R6114:Lpar5	UTSW	6	125081676	missense	probably damaging	1.00
R7197:Lpar5	UTSW	6	125082384	missense	probably benign	0.00
R7779:Lpar5	UTSW	6	125082244	missense	probably damaging	1.00
R8193:Lpar5	UTSW	6	125081339	missense	probably benign
R8264:Lpar5	UTSW	6	125081502	missense	probably damaging	1.00
V7580:Lpar5	UTSW	6	125081727	missense	possibly damaging	0.88
V7582:Lpar5	UTSW	6	125081727	missense	possibly damaging	0.88
Z1176:Lpar5	UTSW	6	125081379	missense	possibly damaging	0.92
Z1176:Lpar5	UTSW	6	125082072	missense	probably damaging	1.00
Z1177:Lpar5	UTSW	6	125082018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCAATTCTTCAGCCAACACGAC -3'
(R):5'- AAGCACAGGCGCACAGTGATGTTC -3'

Sequencing Primer
(F):5'- GTGCCCTGACTATCGAGATAC -3'
(R):5'- CACAGCGAACAGCAGGAT -3'

Posted On

2014-01-29