Incidental Mutation 'V7581:Lpar5'
ID 152553
Institutional Source Beutler Lab
Gene Symbol Lpar5
Ensembl Gene ENSMUSG00000067714
Gene Name lysophosphatidic acid receptor 5
Synonyms LPA5, LOC381810, Gpr92, GPR93
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # V7581 () of strain stinger
Quality Score 106
Status Not validated
Chromosome 6
Chromosomal Location 125067920-125082472 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 125081727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 137 (A137E)
Ref Sequence ENSEMBL: ENSMUSP00000119904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000088292
AA Change: A137E

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714
AA Change: A137E

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 7.4e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140346
AA Change: A137E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714
AA Change: A137E

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 164 1.5e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171989
AA Change: A137E

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714
AA Change: A137E

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203956
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 123,969,761 probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Lpar5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Lpar5 APN 6 125082006 missense possibly damaging 0.94
IGL01830:Lpar5 APN 6 125081822 missense probably benign 0.01
IGL01975:Lpar5 APN 6 125081787 missense probably damaging 0.99
IGL02021:Lpar5 APN 6 125081992 nonsense probably null
IGL02718:Lpar5 APN 6 125082244 missense probably damaging 1.00
IGL03027:Lpar5 APN 6 125082240 missense probably damaging 1.00
IGL03300:Lpar5 APN 6 125082240 missense probably damaging 1.00
F5770:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
R0633:Lpar5 UTSW 6 125081991 missense probably benign 0.25
R1639:Lpar5 UTSW 6 125081601 missense probably damaging 1.00
R1822:Lpar5 UTSW 6 125081415 missense possibly damaging 0.76
R2227:Lpar5 UTSW 6 125081135 critical splice acceptor site probably null
R4019:Lpar5 UTSW 6 125081675 missense probably damaging 1.00
R4288:Lpar5 UTSW 6 125081864 missense probably benign 0.00
R4705:Lpar5 UTSW 6 125082207 missense possibly damaging 0.64
R4787:Lpar5 UTSW 6 125082498 splice site probably null
R5027:Lpar5 UTSW 6 125082147 missense possibly damaging 0.69
R6114:Lpar5 UTSW 6 125081676 missense probably damaging 1.00
R7197:Lpar5 UTSW 6 125082384 missense probably benign 0.00
R7779:Lpar5 UTSW 6 125082244 missense probably damaging 1.00
R8193:Lpar5 UTSW 6 125081339 missense probably benign
R8264:Lpar5 UTSW 6 125081502 missense probably damaging 1.00
R9460:Lpar5 UTSW 6 125081271 start gained probably benign
V7580:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7582:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
Z1176:Lpar5 UTSW 6 125081379 missense possibly damaging 0.92
Z1176:Lpar5 UTSW 6 125082072 missense probably damaging 1.00
Z1177:Lpar5 UTSW 6 125082018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCAATTCTTCAGCCAACACGAC -3'
(R):5'- AAGCACAGGCGCACAGTGATGTTC -3'

Sequencing Primer
(F):5'- GTGCCCTGACTATCGAGATAC -3'
(R):5'- CACAGCGAACAGCAGGAT -3'
Posted On 2014-01-29