Mutagenetix > Incidental Mutation

Incidental Mutation 'V7581:Vmn2r68'

152555

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

V7581 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85221880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 732 (V732I)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061074
AA Change: V732I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: V732I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Abcb10	GGCCATCG	GG	8: 123,969,761		probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Clasp1	G	A	1: 118,581,348	R1027Q	probably damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Glrx3	A	G	7: 137,459,153	H172R	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Hira	G	A	16: 18,894,821	A29T	probably damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr480	G	T	7: 108,066,678	T40K	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Prkcb	G	T	7: 122,528,476	W274C	probably damaging	Het
Rbbp8nl	T	A	2: 180,278,208	T558S	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Slc5a6	C	T	5: 31,042,613		probably null	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tmc3	T	C	7: 83,622,505	V955A	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCAGAACACCAACATGCTGAATGTC -3'
(R):5'- ACTTTACATTGGTCATCCCACTGCG -3'

Sequencing Primer
(F):5'- CCAACATGCTGAATGTCAAGAG -3'
(R):5'- CAGCAGACCACTTTTGTGATTG -3'

Posted On

2014-01-29