Incidental Mutation 'V7581:Gm4787'
ID 152569
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # V7581 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 81376991-81379464 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 81377567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 606 (Q606*)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably null
Transcript: ENSMUST00000062182
AA Change: Q606*
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: Q606*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 123,969,761 probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81377905 missense probably benign 0.01
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81378151 missense probably benign 0.00
R8314:Gm4787 UTSW 12 81379135 missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81377506 missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81377269 missense probably benign 0.00
R9103:Gm4787 UTSW 12 81378715 missense probably benign 0.06
R9457:Gm4787 UTSW 12 81379246 missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81379300 nonsense probably null
R9608:Gm4787 UTSW 12 81378312 missense probably benign 0.03
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTTGTTACACACCCCTCTGAAG -3'
(R):5'- ACCGTCATTTGCAGTGTCAAGCTC -3'

Sequencing Primer
(F):5'- CCCCTCTGAAGTTACATGAACTAATG -3'
(R):5'- AGTGTCAAGCTCTTTTTGGATACC -3'
Posted On 2014-01-29