Mutagenetix > Incidental Mutation

Incidental Mutation 'V7581:Papln'

152570

Institutional Source

Beutler Lab

Gene Symbol

Papln

Ensembl Gene

ENSMUSG00000021223

Gene Name

papilin, proteoglycan-like sulfated glycoprotein

Synonyms

E030033C16Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

V7581 () of strain stinger

Quality Score

109

Status

Not validated

Chromosome

Chromosomal Location

83763634-83792382 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83778834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 608 (R608C)

Ref Sequence

ENSEMBL: ENSMUSP00000021646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]

AlphaFold

Q9EPX2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021646
AA Change: R608C

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: R608C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TSP1	30	81	3.36e-11	SMART
low complexity region	147	161	N/A	INTRINSIC
Pfam:ADAM_spacer1	184	299	3.3e-39	PFAM
TSP1	309	362	1.2e-7	SMART
TSP1	366	426	2.76e-7	SMART
TSP1	427	482	1.42e-9	SMART
TSP1	488	540	2.47e-9	SMART
low complexity region	604	621	N/A	INTRINSIC
KU	748	801	1.83e-22	SMART
low complexity region	822	831	N/A	INTRINSIC
IGc2	917	980	2.88e-4	SMART
IGc2	1056	1119	2.66e-17	SMART
IGc2	1145	1209	2.13e-7	SMART
Pfam:PLAC	1234	1268	2.3e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121733
AA Change: R630C

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: R630C

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
TSP1	30	81	3.36e-11	SMART
low complexity region	147	161	N/A	INTRINSIC
Pfam:ADAM_spacer1	184	299	2.8e-38	PFAM
TSP1	309	362	1.2e-7	SMART
TSP1	388	448	1.82e-7	SMART
TSP1	449	504	1.42e-9	SMART
TSP1	510	562	2.47e-9	SMART
low complexity region	626	643	N/A	INTRINSIC
KU	770	823	1.83e-22	SMART
Pfam:Papilin_u7	831	922	1.9e-40	PFAM
IGc2	939	1002	2.88e-4	SMART
IGc2	1078	1141	2.66e-17	SMART
IGc2	1167	1231	2.13e-7	SMART
Pfam:PLAC	1257	1289	1.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152904

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Abcb10	GGCCATCG	GG	8: 123,969,761		probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Clasp1	G	A	1: 118,581,348	R1027Q	probably damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Glrx3	A	G	7: 137,459,153	H172R	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Hira	G	A	16: 18,894,821	A29T	probably damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr480	G	T	7: 108,066,678	T40K	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Prkcb	G	T	7: 122,528,476	W274C	probably damaging	Het
Rbbp8nl	T	A	2: 180,278,208	T558S	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Slc5a6	C	T	5: 31,042,613		probably null	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tmc3	T	C	7: 83,622,505	V955A	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vmn2r68	C	T	7: 85,221,880	V732I	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Papln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00824:Papln	APN	12	83770436	missense	possibly damaging	0.81
IGL01788:Papln	APN	12	83775462	missense	probably benign	0.32
IGL01889:Papln	APN	12	83786835	missense	probably benign	0.25
IGL02499:Papln	APN	12	83780671	missense	probably benign	0.00
IGL02567:Papln	APN	12	83778837	missense	probably benign	0.00
IGL03150:Papln	APN	12	83782984	missense	probably damaging	1.00
IGL03331:Papln	APN	12	83783661	missense	probably benign
F5770:Papln	UTSW	12	83778834	missense	possibly damaging	0.72
R0201:Papln	UTSW	12	83783027	splice site	probably benign
R0389:Papln	UTSW	12	83783379	nonsense	probably null
R0763:Papln	UTSW	12	83791865	missense	possibly damaging	0.54
R1508:Papln	UTSW	12	83782916	missense	probably damaging	0.99
R1628:Papln	UTSW	12	83784406	splice site	probably benign
R1920:Papln	UTSW	12	83789254	nonsense	probably null
R1974:Papln	UTSW	12	83782037	missense	probably damaging	0.98
R2004:Papln	UTSW	12	83773218	missense	probably damaging	1.00
R2105:Papln	UTSW	12	83780236	missense	probably benign	0.04
R2876:Papln	UTSW	12	83778927	missense	probably damaging	0.96
R4199:Papln	UTSW	12	83783392	missense	probably null	0.01
R4702:Papln	UTSW	12	83781983	missense	probably benign	0.01
R4705:Papln	UTSW	12	83777208	splice site	probably null
R4835:Papln	UTSW	12	83774420	missense	probably damaging	0.99
R4874:Papln	UTSW	12	83777143	missense	probably benign	0.01
R4938:Papln	UTSW	12	83782903	missense	probably benign	0.35
R5000:Papln	UTSW	12	83774889	missense	probably damaging	1.00
R5149:Papln	UTSW	12	83771882	splice site	probably null
R5324:Papln	UTSW	12	83774571	missense	probably damaging	1.00
R5784:Papln	UTSW	12	83781980	missense	probably benign
R5881:Papln	UTSW	12	83771878	missense	probably null	0.91
R5977:Papln	UTSW	12	83784369	nonsense	probably null
R6035:Papln	UTSW	12	83774680	missense	probably damaging	1.00
R6035:Papln	UTSW	12	83774680	missense	probably damaging	1.00
R6291:Papln	UTSW	12	83783015	missense	probably benign	0.01
R6461:Papln	UTSW	12	83781813	splice site	probably null
R6536:Papln	UTSW	12	83781887	missense	probably damaging	1.00
R6861:Papln	UTSW	12	83774949	missense	probably damaging	1.00
R6898:Papln	UTSW	12	83777460	missense	probably benign	0.03
R6953:Papln	UTSW	12	83781885	nonsense	probably null
R7155:Papln	UTSW	12	83776521	missense	probably damaging	1.00
R7450:Papln	UTSW	12	83780171	missense	probably benign	0.13
R7510:Papln	UTSW	12	83772173	missense	probably damaging	0.99
R7850:Papln	UTSW	12	83780662	missense	probably damaging	1.00
R7977:Papln	UTSW	12	83775382	missense	probably damaging	1.00
R7987:Papln	UTSW	12	83775382	missense	probably damaging	1.00
R8321:Papln	UTSW	12	83774941	nonsense	probably null
R8324:Papln	UTSW	12	83786619	missense	probably damaging	1.00
R8466:Papln	UTSW	12	83778481	critical splice acceptor site	probably null
R8743:Papln	UTSW	12	83782990	missense	probably damaging	1.00
R8790:Papln	UTSW	12	83777144	missense	probably benign	0.01
R9086:Papln	UTSW	12	83774859	missense	probably damaging	1.00
R9291:Papln	UTSW	12	83778510	missense	probably benign	0.01
R9350:Papln	UTSW	12	83786864	missense	probably damaging	1.00
R9438:Papln	UTSW	12	83771832	missense	probably benign
R9484:Papln	UTSW	12	83791844	missense	probably benign	0.05
V7580:Papln	UTSW	12	83778834	missense	possibly damaging	0.72
V7582:Papln	UTSW	12	83778834	missense	possibly damaging	0.72
Z1088:Papln	UTSW	12	83776376	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TTACTTGGTTCCCTACAGAGGTCCC -3'
(R):5'- AGTCTCAACCCACCTGCTCTGAAG -3'

Sequencing Primer
(F):5'- CGGGACCTATCATCTATGAGTCTG -3'
(R):5'- CACCTGCTCTGAAGACATGAGG -3'

Posted On

2014-01-29