Incidental Mutation 'V7581:Ppwd1'
ID 152575
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Name peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms 4632422M10Rik, A330090G21Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # V7581 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 104341632-104365351 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104356745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 257 (Y257H)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
AlphaFold Q8CEC6
Predicted Effect probably damaging
Transcript: ENSMUST00000022226
AA Change: Y257H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: Y257H

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225798
Meta Mutation Damage Score 0.2204 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,050 (GRCm39) H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 124,696,500 (GRCm39) probably benign Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Clasp1 G A 1: 118,509,078 (GRCm39) R1027Q probably damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Dpyd C T 3: 118,690,775 (GRCm39) Q295* probably null Het
Dync2i1 A C 12: 116,175,460 (GRCm39) S906A possibly damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Fcgr1 T C 3: 96,191,592 (GRCm39) *405W probably null Het
Glrx3 A G 7: 137,060,882 (GRCm39) H172R probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Hira G A 16: 18,713,571 (GRCm39) A29T probably damaging Het
Hnrnpab A T 11: 51,493,451 (GRCm39) N252K probably benign Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Muc6 T G 7: 141,233,880 (GRCm39) E808A probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5p57 G T 7: 107,665,885 (GRCm39) T40K probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Prkcb G T 7: 122,127,699 (GRCm39) W274C probably damaging Het
Rbbp8nl T A 2: 179,920,001 (GRCm39) T558S probably benign Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Slc5a6 C T 5: 31,199,957 (GRCm39) probably null Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Tmc3 T C 7: 83,271,713 (GRCm39) V955A probably benign Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Toe1 A T 4: 116,663,308 (GRCm39) N56K probably damaging Het
Tprkb A G 6: 85,905,764 (GRCm39) K150E probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Vmn2r68 C T 7: 84,871,088 (GRCm39) V732I probably benign Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zfp933 G A 4: 147,910,927 (GRCm39) A223V probably damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104,353,651 (GRCm39) missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104,350,212 (GRCm39) missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104,356,972 (GRCm39) missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104,353,624 (GRCm39) missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104,359,645 (GRCm39) missense probably benign
IGL02803:Ppwd1 APN 13 104,350,192 (GRCm39) missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104,346,261 (GRCm39) missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104,359,468 (GRCm39) critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104,356,771 (GRCm39) missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104,343,650 (GRCm39) missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104,353,753 (GRCm39) missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104,356,571 (GRCm39) missense probably benign
R2353:Ppwd1 UTSW 13 104,350,090 (GRCm39) missense probably benign
R2382:Ppwd1 UTSW 13 104,343,621 (GRCm39) missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104,350,198 (GRCm39) missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104,346,167 (GRCm39) missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104,356,616 (GRCm39) missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104,356,943 (GRCm39) missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104,356,943 (GRCm39) missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104,361,952 (GRCm39) missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104,356,906 (GRCm39) missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104,344,538 (GRCm39) nonsense probably null
R7095:Ppwd1 UTSW 13 104,342,134 (GRCm39) missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104,343,680 (GRCm39) missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104,350,106 (GRCm39) missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104,356,798 (GRCm39) missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104,353,714 (GRCm39) missense probably damaging 1.00
R9259:Ppwd1 UTSW 13 104,359,612 (GRCm39) missense probably damaging 1.00
R9354:Ppwd1 UTSW 13 104,342,080 (GRCm39) missense probably benign 0.00
R9408:Ppwd1 UTSW 13 104,346,155 (GRCm39) missense possibly damaging 0.74
V7580:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGAATCCCAACTTCTGTCACAGC -3'
(R):5'- GTGGATATATTGCCCAGGAGATGCC -3'

Sequencing Primer
(F):5'- CATcaatgcaagattaaagacaactg -3'
(R):5'- TATTGCCCAGGAGATGCCATATC -3'
Posted On 2014-01-29