Mutagenetix > Incidental Mutations

Incidental Mutation 'V7581:Trps1'

152578

Institutional Source

Beutler Lab

Gene Symbol

Trps1

Ensembl Gene

ENSMUSG00000038679

Gene Name

transcriptional repressor GATA binding 1

Synonyms

D15Ertd586e

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

V7581 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50654752-50890463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50831577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 150 (K150E)

Ref Sequence

ENSEMBL: ENSMUSP00000139063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183421] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000077935
AA Change: K437E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: K437E

Domain	Start	End	E-Value	Type
ZnF_C2H2	222	247	1.41e0	SMART
ZnF_C2H2	333	358	4.45e0	SMART
ZnF_C2H2	434	459	1.31e2	SMART
ZnF_C2H2	523	554	1.93e2	SMART
low complexity region	597	602	N/A	INTRINSIC
ZnF_C2H2	614	637	8.67e-1	SMART
ZnF_C2H2	666	689	2.29e0	SMART
ZnF_C2H2	692	715	8.22e-2	SMART
low complexity region	766	779	N/A	INTRINSIC
ZnF_GATA	890	940	3.95e-16	SMART
low complexity region	1050	1062	N/A	INTRINSIC
ZnF_C2H2	1215	1237	4.34e0	SMART
ZnF_C2H2	1243	1267	5.72e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165201
AA Change: K437E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: K437E

Domain	Start	End	E-Value	Type
ZnF_C2H2	222	247	1.41e0	SMART
ZnF_C2H2	333	358	4.45e0	SMART
ZnF_C2H2	434	459	1.31e2	SMART
ZnF_C2H2	523	554	1.93e2	SMART
low complexity region	597	602	N/A	INTRINSIC
ZnF_C2H2	614	637	8.67e-1	SMART
ZnF_C2H2	666	689	2.29e0	SMART
ZnF_C2H2	692	715	8.22e-2	SMART
low complexity region	766	779	N/A	INTRINSIC
ZnF_GATA	890	940	3.95e-16	SMART
low complexity region	1050	1062	N/A	INTRINSIC
ZnF_C2H2	1215	1237	4.34e0	SMART
ZnF_C2H2	1243	1267	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183421

SMART Domains

Protein: ENSMUSP00000138835
Gene: ENSMUSG00000038679

Domain	Start	End	E-Value	Type
ZnF_C2H2	26	49	8.22e-2	SMART
low complexity region	100	113	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183757
AA Change: K441E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: K441E

Domain	Start	End	E-Value	Type
ZnF_C2H2	226	251	1.41e0	SMART
ZnF_C2H2	337	362	4.45e0	SMART
ZnF_C2H2	438	463	1.31e2	SMART
ZnF_C2H2	527	558	1.93e2	SMART
low complexity region	601	606	N/A	INTRINSIC
ZnF_C2H2	618	641	8.67e-1	SMART
ZnF_C2H2	670	693	2.29e0	SMART
ZnF_C2H2	696	719	8.22e-2	SMART
low complexity region	770	783	N/A	INTRINSIC
ZnF_GATA	894	944	3.95e-16	SMART
low complexity region	1054	1066	N/A	INTRINSIC
ZnF_C2H2	1219	1241	4.34e0	SMART
ZnF_C2H2	1247	1271	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183997

SMART Domains

Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679

Domain	Start	End	E-Value	Type
ZnF_C2H2	226	251	1.41e0	SMART
ZnF_C2H2	337	362	4.45e0	SMART
ZnF_C2H2	470	493	2.29e0	SMART
ZnF_C2H2	496	519	8.22e-2	SMART
low complexity region	570	583	N/A	INTRINSIC
ZnF_GATA	705	755	3.95e-16	SMART
low complexity region	865	877	N/A	INTRINSIC
ZnF_C2H2	1030	1052	4.34e0	SMART
ZnF_C2H2	1058	1082	5.72e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184458
AA Change: K150E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: K150E

Domain	Start	End	E-Value	Type
ZnF_C2H2	46	71	4.45e0	SMART
ZnF_C2H2	147	172	1.31e2	SMART
ZnF_C2H2	236	267	1.93e2	SMART
low complexity region	310	315	N/A	INTRINSIC
ZnF_C2H2	327	350	8.67e-1	SMART
ZnF_C2H2	379	402	2.29e0	SMART
ZnF_C2H2	405	428	8.22e-2	SMART
low complexity region	479	492	N/A	INTRINSIC
ZnF_GATA	603	653	3.95e-16	SMART
low complexity region	763	775	N/A	INTRINSIC
ZnF_C2H2	928	950	4.34e0	SMART
ZnF_C2H2	956	980	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184885

SMART Domains

Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679

Domain	Start	End	E-Value	Type
ZnF_C2H2	176	201	1.41e0	SMART
ZnF_C2H2	287	312	4.45e0	SMART
ZnF_C2H2	420	443	2.29e0	SMART
ZnF_C2H2	446	469	8.22e-2	SMART
low complexity region	520	533	N/A	INTRINSIC
ZnF_GATA	644	694	3.95e-16	SMART
low complexity region	804	816	N/A	INTRINSIC
ZnF_C2H2	969	991	4.34e0	SMART
ZnF_C2H2	997	1021	5.72e-1	SMART

Meta Mutation Damage Score

0.4292

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Abcb10	GGCCATCG	GG	8: 123,969,761		probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Clasp1	G	A	1: 118,581,348	R1027Q	probably damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Glrx3	A	G	7: 137,459,153	H172R	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Hira	G	A	16: 18,894,821	A29T	probably damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr480	G	T	7: 108,066,678	T40K	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Prkcb	G	T	7: 122,528,476	W274C	probably damaging	Het
Rbbp8nl	T	A	2: 180,278,208	T558S	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Slc5a6	C	T	5: 31,042,613		probably null	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tmc3	T	C	7: 83,622,505	V955A	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vmn2r68	C	T	7: 85,221,880	V732I	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Trps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Trps1	APN	15	50846870	missense	probably benign	0.07
IGL00497:Trps1	APN	15	50661307	missense	possibly damaging	0.91
IGL00558:Trps1	APN	15	50661085	missense	probably damaging	1.00
IGL01325:Trps1	APN	15	50846814	missense	probably benign	0.40
IGL02132:Trps1	APN	15	50822278	missense	probably damaging	1.00
IGL02631:Trps1	APN	15	50846021	missense	probably damaging	1.00
IGL02740:Trps1	APN	15	50846539	missense	probably damaging	1.00
IGL02821:Trps1	APN	15	50660877	missense	probably damaging	1.00
IGL03096:Trps1	APN	15	50846479	missense	probably benign
F5770:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
R0050:Trps1	UTSW	15	50765525	missense	probably benign	0.18
R0244:Trps1	UTSW	15	50664743	missense	probably damaging	1.00
R0377:Trps1	UTSW	15	50831778	nonsense	probably null
R0599:Trps1	UTSW	15	50831860	nonsense	probably null
R0848:Trps1	UTSW	15	50661549	missense	possibly damaging	0.54
R1744:Trps1	UTSW	15	50661213	missense	probably damaging	1.00
R1830:Trps1	UTSW	15	50661136	missense	probably damaging	0.99
R2083:Trps1	UTSW	15	50822305	missense	probably damaging	1.00
R2167:Trps1	UTSW	15	50831730	missense	possibly damaging	0.94
R2267:Trps1	UTSW	15	50822398	missense	probably damaging	1.00
R2314:Trps1	UTSW	15	50661346	missense	probably damaging	1.00
R3735:Trps1	UTSW	15	50846060	missense	possibly damaging	0.94
R4133:Trps1	UTSW	15	50831387	missense	probably damaging	1.00
R4223:Trps1	UTSW	15	50846648	missense	probably benign
R4280:Trps1	UTSW	15	50846082	missense	probably benign	0.00
R4566:Trps1	UTSW	15	50831678	missense	probably damaging	1.00
R4810:Trps1	UTSW	15	50822296	missense	probably benign	0.14
R4828:Trps1	UTSW	15	50660677	makesense	probably null
R4838:Trps1	UTSW	15	50827316	missense	probably benign	0.05
R4852:Trps1	UTSW	15	50846309	missense	probably damaging	1.00
R5001:Trps1	UTSW	15	50661307	missense	possibly damaging	0.91
R5311:Trps1	UTSW	15	50664760	missense	probably damaging	1.00
R5463:Trps1	UTSW	15	50831890	nonsense	probably null
R5677:Trps1	UTSW	15	50846108	missense	probably damaging	1.00
R5691:Trps1	UTSW	15	50827304	missense	probably benign
R6432:Trps1	UTSW	15	50831397	missense	probably damaging	0.96
R6528:Trps1	UTSW	15	50822427	missense	probably benign	0.01
R6594:Trps1	UTSW	15	50830955	missense	probably damaging	0.99
R6827:Trps1	UTSW	15	50822563	missense	probably benign	0.14
R6862:Trps1	UTSW	15	50831605	critical splice donor site	probably null
R6912:Trps1	UTSW	15	50822298	missense	possibly damaging	0.92
R7151:Trps1	UTSW	15	50822397	missense	possibly damaging	0.95
R7846:Trps1	UTSW	15	50831877	missense	probably damaging	0.99
R7857:Trps1	UTSW	15	50661005	missense	probably damaging	1.00
R7986:Trps1	UTSW	15	50661736	missense	probably damaging	1.00
R7986:Trps1	UTSW	15	50889623	missense	probably benign	0.00
R8744:Trps1	UTSW	15	50661246	missense	probably damaging	1.00
R8838:Trps1	UTSW	15	50889611	missense	probably benign	0.01
R8859:Trps1	UTSW	15	50822373	missense	possibly damaging	0.77
R8935:Trps1	UTSW	15	50888948	nonsense	probably null
R9044:Trps1	UTSW	15	50822607	missense	probably benign	0.11
R9142:Trps1	UTSW	15	50661262	missense	probably damaging	0.98
R9211:Trps1	UTSW	15	50831444	missense	probably damaging	1.00
R9283:Trps1	UTSW	15	50831051	missense	probably damaging	1.00
R9363:Trps1	UTSW	15	50661280	missense	probably damaging	1.00
R9402:Trps1	UTSW	15	50846256	missense	probably damaging	1.00
V7580:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
V7583:Trps1	UTSW	15	50831577	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGACCCACTACAATCACATCAGG -3'
(R):5'- GCAACATTTTCTTCAGACGCACCC -3'

Sequencing Primer
(F):5'- TCCCTTGCTGGGGAAGTC -3'
(R):5'- TCCTCCGAGGGTGTGAAAC -3'

Posted On

2014-01-29