Incidental Mutation 'V7581:Recql4'
ID 152579
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene Name RecQ protein-like 4
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # V7581 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 76587753-76594748 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76590369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 705 (D705G)
Ref Sequence ENSEMBL: ENSMUSP00000044363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000230544] [ENSMUST00000155225] [ENSMUST00000155735] [ENSMUST00000230724] [ENSMUST00000142610]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000036852
AA Change: D705G

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: D705G

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000230544
AA Change: D612G

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,050 (GRCm39) H102L possibly damaging Het
Abcb10 GGCCATCG GG 8: 124,696,500 (GRCm39) probably benign Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Clasp1 G A 1: 118,509,078 (GRCm39) R1027Q probably damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Dpyd C T 3: 118,690,775 (GRCm39) Q295* probably null Het
Dync2i1 A C 12: 116,175,460 (GRCm39) S906A possibly damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Fcgr1 T C 3: 96,191,592 (GRCm39) *405W probably null Het
Glrx3 A G 7: 137,060,882 (GRCm39) H172R probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Hira G A 16: 18,713,571 (GRCm39) A29T probably damaging Het
Hnrnpab A T 11: 51,493,451 (GRCm39) N252K probably benign Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Muc6 T G 7: 141,233,880 (GRCm39) E808A probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5p57 G T 7: 107,665,885 (GRCm39) T40K probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Prkcb G T 7: 122,127,699 (GRCm39) W274C probably damaging Het
Rbbp8nl T A 2: 179,920,001 (GRCm39) T558S probably benign Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Slc5a6 C T 5: 31,199,957 (GRCm39) probably null Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Tmc3 T C 7: 83,271,713 (GRCm39) V955A probably benign Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Toe1 A T 4: 116,663,308 (GRCm39) N56K probably damaging Het
Tprkb A G 6: 85,905,764 (GRCm39) K150E probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Vmn2r68 C T 7: 84,871,088 (GRCm39) V732I probably benign Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zfp933 G A 4: 147,910,927 (GRCm39) A223V probably damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76,591,536 (GRCm39) missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76,594,112 (GRCm39) splice site probably benign
IGL01470:Recql4 APN 15 76,593,144 (GRCm39) missense probably benign 0.40
IGL01809:Recql4 APN 15 76,593,070 (GRCm39) nonsense probably null
IGL02094:Recql4 APN 15 76,593,717 (GRCm39) missense probably benign 0.01
IGL02303:Recql4 APN 15 76,592,771 (GRCm39) missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76,591,485 (GRCm39) missense probably damaging 1.00
IGL03086:Recql4 APN 15 76,590,468 (GRCm39) missense probably benign 0.30
IGL03162:Recql4 APN 15 76,590,296 (GRCm39) splice site probably null
ANU74:Recql4 UTSW 15 76,589,957 (GRCm39) missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76,590,369 (GRCm39) missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76,594,009 (GRCm39) splice site probably null
R1171:Recql4 UTSW 15 76,588,239 (GRCm39) missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76,593,411 (GRCm39) missense probably benign 0.01
R1487:Recql4 UTSW 15 76,593,183 (GRCm39) missense probably benign 0.11
R1547:Recql4 UTSW 15 76,590,511 (GRCm39) missense probably damaging 0.99
R1917:Recql4 UTSW 15 76,588,037 (GRCm39) nonsense probably null
R3813:Recql4 UTSW 15 76,588,694 (GRCm39) missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76,590,027 (GRCm39) missense probably damaging 1.00
R4363:Recql4 UTSW 15 76,590,244 (GRCm39) missense probably benign 0.07
R4387:Recql4 UTSW 15 76,590,158 (GRCm39) missense probably benign 0.00
R4388:Recql4 UTSW 15 76,590,158 (GRCm39) missense probably benign 0.00
R4700:Recql4 UTSW 15 76,592,785 (GRCm39) missense probably damaging 1.00
R4701:Recql4 UTSW 15 76,592,785 (GRCm39) missense probably damaging 1.00
R4923:Recql4 UTSW 15 76,594,381 (GRCm39) missense probably damaging 1.00
R5075:Recql4 UTSW 15 76,593,744 (GRCm39) missense probably damaging 1.00
R5103:Recql4 UTSW 15 76,590,956 (GRCm39) missense probably damaging 1.00
R5226:Recql4 UTSW 15 76,594,329 (GRCm39) missense probably benign
R5500:Recql4 UTSW 15 76,589,778 (GRCm39) intron probably benign
R5547:Recql4 UTSW 15 76,589,994 (GRCm39) nonsense probably null
R5824:Recql4 UTSW 15 76,592,785 (GRCm39) missense probably damaging 1.00
R5976:Recql4 UTSW 15 76,593,624 (GRCm39) missense probably benign 0.01
R6086:Recql4 UTSW 15 76,588,787 (GRCm39) missense probably damaging 0.96
R6756:Recql4 UTSW 15 76,589,059 (GRCm39) missense probably benign 0.00
R7075:Recql4 UTSW 15 76,590,624 (GRCm39) missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76,589,753 (GRCm39) missense unknown
R7449:Recql4 UTSW 15 76,589,765 (GRCm39) missense unknown
R7653:Recql4 UTSW 15 76,587,982 (GRCm39) missense probably benign 0.01
R8314:Recql4 UTSW 15 76,594,380 (GRCm39) missense probably damaging 1.00
R8480:Recql4 UTSW 15 76,588,705 (GRCm39) missense probably benign 0.03
R8737:Recql4 UTSW 15 76,593,054 (GRCm39) missense probably benign 0.00
R8789:Recql4 UTSW 15 76,588,546 (GRCm39) missense probably benign
R9093:Recql4 UTSW 15 76,589,685 (GRCm39) missense unknown
V7580:Recql4 UTSW 15 76,590,369 (GRCm39) missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76,590,369 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCATGCCAGCATGGTAGGCTTC -3'
(R):5'- AGCACTGTCCTGGTTCAGGTTCTC -3'

Sequencing Primer
(F):5'- TGACTGATGAGACCACAGC -3'
(R):5'- TCTCCGGGAGCATATGGG -3'
Posted On 2014-01-29