Incidental Mutation 'V7582:Spaca1'
ID 152594
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Name sperm acrosome associated 1
Synonyms 1700124L11Rik, 4930540L03Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # V7582 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 34024872-34050067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34039311 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 192 (E192G)
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734] [ENSMUST00000108148]
AlphaFold Q9DA48
Predicted Effect probably damaging
Transcript: ENSMUST00000029927
AA Change: E192G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264
AA Change: E192G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084734
AA Change: E192G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264
AA Change: E192G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108148
AA Change: E74G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103783
Gene: ENSMUSG00000028264
AA Change: E74G

DomainStartEndE-ValueType
transmembrane domain 109 131 N/A INTRINSIC
Meta Mutation Damage Score 0.1651 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,050 (GRCm39) H102L possibly damaging Het
Ahcy G A 2: 154,906,841 (GRCm39) R151* probably null Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Cdc42bpb C T 12: 111,262,825 (GRCm39) G1501S probably benign Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Dpyd C T 3: 118,690,775 (GRCm39) Q295* probably null Het
Dync2i1 A C 12: 116,175,460 (GRCm39) S906A possibly damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Fbrsl1 C T 5: 110,527,292 (GRCm39) A129T possibly damaging Het
Fcgr1 T C 3: 96,191,592 (GRCm39) *405W probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Hira G A 16: 18,713,571 (GRCm39) A29T probably damaging Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Med20 G A 17: 47,929,757 (GRCm39) V65M probably damaging Het
Myrfl T C 10: 116,697,435 (GRCm39) T30A probably damaging Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Rbbp8nl T A 2: 179,920,001 (GRCm39) T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,672,549 (GRCm39) probably benign Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Thbd A T 2: 148,249,110 (GRCm39) Y253N probably benign Het
Tiam1 C T 16: 89,662,159 (GRCm39) R653H probably damaging Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Toe1 A T 4: 116,663,308 (GRCm39) N56K probably damaging Het
Tprkb A G 6: 85,905,764 (GRCm39) K150E probably damaging Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zfp933 G A 4: 147,910,927 (GRCm39) A223V probably damaging Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34,029,077 (GRCm39) missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34,040,894 (GRCm39) missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34,049,838 (GRCm39) small insertion probably benign
FR4548:Spaca1 UTSW 4 34,049,856 (GRCm39) small insertion probably benign
FR4737:Spaca1 UTSW 4 34,049,836 (GRCm39) small insertion probably benign
FR4976:Spaca1 UTSW 4 34,049,849 (GRCm39) small insertion probably benign
FR4976:Spaca1 UTSW 4 34,049,844 (GRCm39) small insertion probably benign
R0377:Spaca1 UTSW 4 34,044,267 (GRCm39) splice site probably null
R1861:Spaca1 UTSW 4 34,044,206 (GRCm39) missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34,028,468 (GRCm39) missense probably damaging 1.00
R4930:Spaca1 UTSW 4 34,044,236 (GRCm39) missense possibly damaging 0.65
R5030:Spaca1 UTSW 4 34,039,247 (GRCm39) missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34,029,095 (GRCm39) missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34,049,863 (GRCm39) missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34,029,176 (GRCm39) missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34,049,869 (GRCm39) missense probably benign 0.00
R8039:Spaca1 UTSW 4 34,044,207 (GRCm39) missense probably damaging 0.99
R8094:Spaca1 UTSW 4 34,049,837 (GRCm39) missense possibly damaging 0.55
R8134:Spaca1 UTSW 4 34,042,157 (GRCm39) splice site probably null
R9120:Spaca1 UTSW 4 34,029,168 (GRCm39) missense probably damaging 0.97
RF006:Spaca1 UTSW 4 34,049,853 (GRCm39) small insertion probably benign
RF017:Spaca1 UTSW 4 34,049,853 (GRCm39) small insertion probably benign
RF032:Spaca1 UTSW 4 34,049,854 (GRCm39) small insertion probably benign
RF043:Spaca1 UTSW 4 34,049,846 (GRCm39) small insertion probably benign
RF044:Spaca1 UTSW 4 34,049,846 (GRCm39) small insertion probably benign
RF044:Spaca1 UTSW 4 34,049,854 (GRCm39) small insertion probably benign
RF060:Spaca1 UTSW 4 34,049,841 (GRCm39) small insertion probably benign
V7580:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7581:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
V7583:Spaca1 UTSW 4 34,039,311 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTTCCTGTAATTTATGTGCCAGATCC -3'
(R):5'- AGCAACTCTCCTTTTGTTAGAGTGCTTC -3'

Sequencing Primer
(F):5'- actaagtcagaagctctagtgtg -3'
(R):5'- GGCAACCTATTGTGTTTGCTAATG -3'
Posted On 2014-01-29