Incidental Mutation 'V7583:Slc30a4'
ID 152631
Institutional Source Beutler Lab
Gene Symbol Slc30a4
Ensembl Gene ENSMUSG00000005802
Gene Name solute carrier family 30 (zinc transporter), member 4
Synonyms Znt4
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # V7583 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 122523153-122544583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122531458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 136 (M136L)
Ref Sequence ENSEMBL: ENSMUSP00000097056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]
AlphaFold O35149
Predicted Effect probably benign
Transcript: ENSMUST00000005952
AA Change: M185L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: M185L

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 114 333 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099457
AA Change: M136L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802
AA Change: M136L

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 124 368 4.6e-46 PFAM
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,050 (GRCm39) H102L possibly damaging Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Cdc42bpb C T 12: 111,262,825 (GRCm39) G1501S probably benign Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dcaf4 C A 12: 83,584,475 (GRCm39) probably null Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Dpyd C T 3: 118,690,775 (GRCm39) Q295* probably null Het
Dync2i1 A C 12: 116,175,460 (GRCm39) S906A possibly damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Fcgr1 T C 3: 96,191,592 (GRCm39) *405W probably null Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Golga4 A G 9: 118,385,143 (GRCm39) E727G possibly damaging Het
Hnrnpab A T 11: 51,493,451 (GRCm39) N252K probably benign Het
Ing1 T C 8: 11,611,934 (GRCm39) V124A probably damaging Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Mbd5 A G 2: 49,206,422 (GRCm39) D1713G probably damaging Het
Muc6 T G 7: 141,233,880 (GRCm39) E808A probably benign Het
Mylk G T 16: 34,815,574 (GRCm39) probably null Het
Nbeal2 A G 9: 110,467,005 (GRCm39) V670A possibly damaging Het
Nphp3 T C 9: 103,913,093 (GRCm39) probably null Het
Numbl T C 7: 26,979,027 (GRCm39) S379P probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pigx T C 16: 31,906,240 (GRCm39) D129G probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Ror1 A G 4: 100,298,130 (GRCm39) Q501R probably damaging Het
Sirpb1b A G 3: 15,568,243 (GRCm39) V366A probably benign Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Toe1 A T 4: 116,663,308 (GRCm39) N56K probably damaging Het
Tprkb A G 6: 85,905,764 (GRCm39) K150E probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Vps18 A G 2: 119,127,709 (GRCm39) Y844C probably benign Het
Wdr72 T A 9: 74,064,552 (GRCm39) I528N probably damaging Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zfp933 G A 4: 147,910,927 (GRCm39) A223V probably damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Slc30a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Slc30a4 APN 2 122,544,308 (GRCm39) missense possibly damaging 0.87
IGL01583:Slc30a4 APN 2 122,527,137 (GRCm39) missense probably benign
IGL01823:Slc30a4 APN 2 122,544,012 (GRCm39) missense probably damaging 1.00
IGL02086:Slc30a4 APN 2 122,543,947 (GRCm39) splice site probably benign
F5770:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
R0060:Slc30a4 UTSW 2 122,527,104 (GRCm39) missense probably benign
R0060:Slc30a4 UTSW 2 122,527,104 (GRCm39) missense probably benign
R0373:Slc30a4 UTSW 2 122,531,319 (GRCm39) missense probably damaging 0.99
R0591:Slc30a4 UTSW 2 122,527,160 (GRCm39) missense probably damaging 1.00
R1514:Slc30a4 UTSW 2 122,531,334 (GRCm39) missense probably damaging 1.00
R1552:Slc30a4 UTSW 2 122,527,936 (GRCm39) missense probably benign 0.05
R3847:Slc30a4 UTSW 2 122,544,192 (GRCm39) missense probably damaging 1.00
R4195:Slc30a4 UTSW 2 122,527,190 (GRCm39) missense probably damaging 1.00
R4501:Slc30a4 UTSW 2 122,527,136 (GRCm39) missense probably benign
R5558:Slc30a4 UTSW 2 122,528,903 (GRCm39) missense probably damaging 1.00
R6379:Slc30a4 UTSW 2 122,531,469 (GRCm39) missense probably damaging 1.00
R6393:Slc30a4 UTSW 2 122,527,966 (GRCm39) missense probably damaging 1.00
R7394:Slc30a4 UTSW 2 122,527,224 (GRCm39) missense possibly damaging 0.93
R9464:Slc30a4 UTSW 2 122,527,200 (GRCm39) missense probably damaging 1.00
R9765:Slc30a4 UTSW 2 122,536,456 (GRCm39) missense probably damaging 1.00
V7580:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
V7581:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
V7582:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTGAGACAGGTGGACAAACTAACAA -3'
(R):5'- AGGCTGTGGAGACATGGTGACT -3'

Sequencing Primer
(F):5'- CATGTGCAATAATCTTTTGGCTC -3'
(R):5'- AGGATCTAAATCATTCAAGCTGC -3'
Posted On 2014-01-29