Incidental Mutation 'V7583:Tspyl3'
ID152634
Institutional Source Beutler Lab
Gene Symbol Tspyl3
Ensembl Gene ENSMUSG00000074671
Gene NameTSPY-like 3
SynonymsLOC241732
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #V7583 () of strain stinger
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location153222370-153225441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153225060 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 86 (V86A)
Ref Sequence ENSEMBL: ENSMUSP00000096799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056924] [ENSMUST00000099194] [ENSMUST00000109795]
Predicted Effect probably benign
Transcript: ENSMUST00000056924
SMART Domains Protein: ENSMUSP00000055709
Gene: ENSMUSG00000051413

DomainStartEndE-ValueType
ZnF_C2H2 68 92 5.99e-4 SMART
ZnF_C2H2 98 120 1.03e-2 SMART
ZnF_C2H2 127 149 1.36e-2 SMART
ZnF_C2H2 156 178 6.23e-2 SMART
ZnF_C2H2 191 213 1.26e-2 SMART
ZnF_C2H2 219 242 3.11e-2 SMART
low complexity region 324 340 N/A INTRINSIC
low complexity region 369 397 N/A INTRINSIC
low complexity region 417 432 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099194
AA Change: V86A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096799
Gene: ENSMUSG00000074671
AA Change: V86A

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:NAP 160 307 2.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109795
SMART Domains Protein: ENSMUSP00000105419
Gene: ENSMUSG00000051413

DomainStartEndE-ValueType
ZnF_C2H2 68 92 5.99e-4 SMART
ZnF_C2H2 98 120 1.03e-2 SMART
ZnF_C2H2 127 149 1.36e-2 SMART
ZnF_C2H2 156 178 6.23e-2 SMART
ZnF_C2H2 191 213 1.26e-2 SMART
ZnF_C2H2 219 242 3.11e-2 SMART
low complexity region 324 340 N/A INTRINSIC
low complexity region 369 397 N/A INTRINSIC
low complexity region 417 432 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Tspyl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
F5770:Tspyl3 UTSW 2 153225060 missense probably benign 0.07
R0035:Tspyl3 UTSW 2 153224320 missense probably damaging 1.00
R0866:Tspyl3 UTSW 2 153224934 missense probably damaging 1.00
R1780:Tspyl3 UTSW 2 153225256 missense probably damaging 0.97
R1930:Tspyl3 UTSW 2 153224797 missense probably damaging 1.00
R3015:Tspyl3 UTSW 2 153224730 missense probably damaging 1.00
R4296:Tspyl3 UTSW 2 153225156 missense possibly damaging 0.96
R5913:Tspyl3 UTSW 2 153224716 missense probably benign 0.17
R6933:Tspyl3 UTSW 2 153225283 missense probably benign
V7580:Tspyl3 UTSW 2 153225060 missense probably benign 0.07
V7581:Tspyl3 UTSW 2 153225060 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCGAGTAGCAATGGACACCAC -3'
(R):5'- ATACAAGAGCGGGATGCACACC -3'

Sequencing Primer
(F):5'- AGGTAGCCAAGCATGTCTTC -3'
(R):5'- CGCCTTCCTCAGAAAACACT -3'
Posted On2014-01-29