Incidental Mutation 'V7583:Zmynd8'
ID152636
Institutional Source Beutler Lab
Gene Symbol Zmynd8
Ensembl Gene ENSMUSG00000039671
Gene Namezinc finger, MYND-type containing 8
Synonyms2010005I16Rik, ZMYND8, RACK7, 1110013E22Rik, 3632413B07Rik, Prkcbp1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #V7583 () of strain stinger
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165784152-165899016 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 165812394 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 724 (R724*)
Ref Sequence ENSEMBL: ENSMUSP00000136211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018050] [ENSMUST00000088113] [ENSMUST00000099084] [ENSMUST00000109266] [ENSMUST00000109269] [ENSMUST00000170272] [ENSMUST00000177633]
Predicted Effect probably null
Transcript: ENSMUST00000018050
AA Change: R729*
SMART Domains Protein: ENSMUSP00000018050
Gene: ENSMUSG00000039671
AA Change: R729*

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 90 131 2.23e-11 SMART
BROMO 147 254 1.77e-17 SMART
Pfam:PWWP 275 349 4e-12 PFAM
Pfam:DUF3544 412 624 9.8e-112 PFAM
internal_repeat_2 640 701 9.06e-5 PROSPERO
low complexity region 770 805 N/A INTRINSIC
low complexity region 853 868 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
coiled coil region 916 978 N/A INTRINSIC
Pfam:zf-MYND 988 1022 2.2e-7 PFAM
low complexity region 1055 1075 N/A INTRINSIC
low complexity region 1142 1156 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088113
AA Change: R724*
SMART Domains Protein: ENSMUSP00000085436
Gene: ENSMUSG00000039671
AA Change: R724*

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 271 346 2.7e-11 PFAM
Pfam:DUF3544 408 617 2.1e-102 PFAM
internal_repeat_2 635 696 4.2e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
low complexity region 1050 1070 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099084
AA Change: R704*
SMART Domains Protein: ENSMUSP00000096683
Gene: ENSMUSG00000039671
AA Change: R704*

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 4.1e-12 PFAM
Pfam:DUF3544 387 599 1e-111 PFAM
internal_repeat_2 615 676 4.95e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 819 844 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 943 1005 N/A INTRINSIC
Pfam:zf-MYND 1015 1049 2.3e-7 PFAM
low complexity region 1082 1102 N/A INTRINSIC
low complexity region 1169 1183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109266
AA Change: R749*
SMART Domains Protein: ENSMUSP00000104889
Gene: ENSMUSG00000039671
AA Change: R749*

DomainStartEndE-ValueType
low complexity region 6 11 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 110 151 2.23e-11 SMART
BROMO 167 274 1.77e-17 SMART
Pfam:PWWP 295 369 4.1e-12 PFAM
Pfam:DUF3544 432 644 1e-111 PFAM
internal_repeat_2 660 721 8.36e-5 PROSPERO
low complexity region 790 825 N/A INTRINSIC
low complexity region 873 888 N/A INTRINSIC
low complexity region 895 907 N/A INTRINSIC
coiled coil region 936 998 N/A INTRINSIC
Pfam:zf-MYND 1008 1042 2.3e-7 PFAM
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1162 1176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109269
AA Change: R733*
SMART Domains Protein: ENSMUSP00000104892
Gene: ENSMUSG00000039671
AA Change: R733*

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
PHD 94 135 2.23e-11 SMART
BROMO 151 258 1.77e-17 SMART
Pfam:PWWP 280 355 6.6e-11 PFAM
Pfam:DUF3544 417 626 2.6e-102 PFAM
internal_repeat_2 644 705 6.15e-5 PROSPERO
low complexity region 774 809 N/A INTRINSIC
low complexity region 848 873 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 931 943 N/A INTRINSIC
coiled coil region 972 1034 N/A INTRINSIC
low complexity region 1111 1131 N/A INTRINSIC
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152682
Predicted Effect probably null
Transcript: ENSMUST00000170272
AA Change: R704*
SMART Domains Protein: ENSMUSP00000128680
Gene: ENSMUSG00000039671
AA Change: R704*

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.1e-11 PFAM
Pfam:DUF3544 387 599 1.9e-111 PFAM
internal_repeat_2 615 676 7.92e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
coiled coil region 891 953 N/A INTRINSIC
Pfam:zf-MYND 963 997 1.1e-6 PFAM
low complexity region 1030 1050 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177633
AA Change: R724*
SMART Domains Protein: ENSMUSP00000136211
Gene: ENSMUSG00000039671
AA Change: R724*

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 9.6e-12 PFAM
Pfam:DUF3544 407 619 1.8e-111 PFAM
internal_repeat_2 635 696 6.45e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
Pfam:zf-MYND 983 1017 6.7e-7 PFAM
low complexity region 1050 1070 N/A INTRINSIC
low complexity region 1137 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Zmynd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Zmynd8 APN 2 165812814 missense probably damaging 1.00
IGL01311:Zmynd8 APN 2 165805209 missense probably damaging 1.00
IGL02317:Zmynd8 APN 2 165820572 missense possibly damaging 0.92
IGL02548:Zmynd8 APN 2 165833405 missense probably damaging 1.00
IGL02798:Zmynd8 APN 2 165852150 critical splice acceptor site probably null
IGL02933:Zmynd8 APN 2 165828318 missense possibly damaging 0.65
cain UTSW 2 165858053 critical splice donor site probably null
F5770:Zmynd8 UTSW 2 165812394 nonsense probably null
I1329:Zmynd8 UTSW 2 165828225 missense probably damaging 1.00
P0031:Zmynd8 UTSW 2 165820698 splice site probably benign
R0267:Zmynd8 UTSW 2 165828402 missense probably damaging 1.00
R0608:Zmynd8 UTSW 2 165787158 splice site probably null
R1663:Zmynd8 UTSW 2 165807885 missense probably benign 0.11
R2212:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3412:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3413:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3749:Zmynd8 UTSW 2 165805198 missense probably damaging 1.00
R3820:Zmynd8 UTSW 2 165815461 nonsense probably null
R3836:Zmynd8 UTSW 2 165858099 missense probably benign 0.05
R3957:Zmynd8 UTSW 2 165812475 missense probably damaging 0.99
R4379:Zmynd8 UTSW 2 165807938 splice site probably null
R4526:Zmynd8 UTSW 2 165807607 intron probably benign
R4739:Zmynd8 UTSW 2 165805329 missense probably damaging 1.00
R4838:Zmynd8 UTSW 2 165840034 nonsense probably null
R4932:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4933:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4997:Zmynd8 UTSW 2 165792816 missense probably benign 0.01
R5652:Zmynd8 UTSW 2 165807698 missense probably damaging 1.00
R5741:Zmynd8 UTSW 2 165840017 missense probably damaging 1.00
R6008:Zmynd8 UTSW 2 165842787 missense possibly damaging 0.77
R6242:Zmynd8 UTSW 2 165898947 missense possibly damaging 0.91
R6332:Zmynd8 UTSW 2 165838852 missense probably damaging 1.00
R6394:Zmynd8 UTSW 2 165846023 nonsense probably null
R6772:Zmynd8 UTSW 2 165807601 missense probably benign 0.35
R6970:Zmynd8 UTSW 2 165875750 missense probably damaging 1.00
R6986:Zmynd8 UTSW 2 165833415 missense probably damaging 1.00
R7229:Zmynd8 UTSW 2 165858053 critical splice donor site probably null
R7266:Zmynd8 UTSW 2 165807572 missense possibly damaging 0.49
R7296:Zmynd8 UTSW 2 165840009 missense probably damaging 0.98
R7642:Zmynd8 UTSW 2 165812426 missense probably damaging 1.00
R7818:Zmynd8 UTSW 2 165842831 missense probably damaging 0.97
R7821:Zmynd8 UTSW 2 165881080 intron probably benign
R8135:Zmynd8 UTSW 2 165812426 missense probably damaging 1.00
V7580:Zmynd8 UTSW 2 165812394 nonsense probably null
V7581:Zmynd8 UTSW 2 165812394 nonsense probably null
Z1088:Zmynd8 UTSW 2 165828171 missense probably benign
Z1176:Zmynd8 UTSW 2 165828188 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTACCAATCTGGGACCCTGAGAC -3'
(R):5'- AGCGATTCCGAGGACTCCGAAAAG -3'

Sequencing Primer
(F):5'- CTGAGACATTCCCTGTCATAGTGG -3'
(R):5'- ACTCTCCTGTCAGCGAGAAG -3'
Posted On2014-01-29