Mutagenetix > Incidental Mutations

Incidental Mutation 'V7583:Zmynd8'

152636

Institutional Source

Beutler Lab

Gene Symbol

Zmynd8

Ensembl Gene

ENSMUSG00000039671

Gene Name

zinc finger, MYND-type containing 8

Synonyms

2010005I16Rik, ZMYND8, RACK7, 1110013E22Rik, 3632413B07Rik, Prkcbp1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

V7583 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

165784152-165899016 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 165812394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 724 (R724*)

Ref Sequence

ENSEMBL: ENSMUSP00000136211 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018050] [ENSMUST00000088113] [ENSMUST00000099084] [ENSMUST00000109266] [ENSMUST00000109269] [ENSMUST00000170272] [ENSMUST00000177633]

AlphaFold

A2A484

Predicted Effect

probably null
Transcript: ENSMUST00000018050
AA Change: R729*

SMART Domains

Protein: ENSMUSP00000018050
Gene: ENSMUSG00000039671
AA Change: R729*

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	37	56	N/A	INTRINSIC
PHD	90	131	2.23e-11	SMART
BROMO	147	254	1.77e-17	SMART
Pfam:PWWP	275	349	4e-12	PFAM
Pfam:DUF3544	412	624	9.8e-112	PFAM
internal_repeat_2	640	701	9.06e-5	PROSPERO
low complexity region	770	805	N/A	INTRINSIC
low complexity region	853	868	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
coiled coil region	916	978	N/A	INTRINSIC
Pfam:zf-MYND	988	1022	2.2e-7	PFAM
low complexity region	1055	1075	N/A	INTRINSIC
low complexity region	1142	1156	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000088113
AA Change: R724*

SMART Domains

Protein: ENSMUSP00000085436
Gene: ENSMUSG00000039671
AA Change: R724*

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	43	54	N/A	INTRINSIC
low complexity region	57	76	N/A	INTRINSIC
PHD	85	126	2.23e-11	SMART
BROMO	142	249	1.77e-17	SMART
Pfam:PWWP	271	346	2.7e-11	PFAM
Pfam:DUF3544	408	617	2.1e-102	PFAM
internal_repeat_2	635	696	4.2e-5	PROSPERO
low complexity region	765	800	N/A	INTRINSIC
low complexity region	848	863	N/A	INTRINSIC
low complexity region	870	882	N/A	INTRINSIC
coiled coil region	911	973	N/A	INTRINSIC
low complexity region	1050	1070	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099084
AA Change: R704*

SMART Domains

Protein: ENSMUSP00000096683
Gene: ENSMUSG00000039671
AA Change: R704*

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	37	56	N/A	INTRINSIC
PHD	65	106	2.23e-11	SMART
BROMO	122	229	1.77e-17	SMART
Pfam:PWWP	250	324	4.1e-12	PFAM
Pfam:DUF3544	387	599	1e-111	PFAM
internal_repeat_2	615	676	4.95e-5	PROSPERO
low complexity region	745	780	N/A	INTRINSIC
low complexity region	819	844	N/A	INTRINSIC
low complexity region	880	895	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
coiled coil region	943	1005	N/A	INTRINSIC
Pfam:zf-MYND	1015	1049	2.3e-7	PFAM
low complexity region	1082	1102	N/A	INTRINSIC
low complexity region	1169	1183	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109266
AA Change: R749*

SMART Domains

Protein: ENSMUSP00000104889
Gene: ENSMUSG00000039671
AA Change: R749*

Domain	Start	End	E-Value	Type
low complexity region	6	11	N/A	INTRINSIC
low complexity region	43	54	N/A	INTRINSIC
low complexity region	57	76	N/A	INTRINSIC
PHD	110	151	2.23e-11	SMART
BROMO	167	274	1.77e-17	SMART
Pfam:PWWP	295	369	4.1e-12	PFAM
Pfam:DUF3544	432	644	1e-111	PFAM
internal_repeat_2	660	721	8.36e-5	PROSPERO
low complexity region	790	825	N/A	INTRINSIC
low complexity region	873	888	N/A	INTRINSIC
low complexity region	895	907	N/A	INTRINSIC
coiled coil region	936	998	N/A	INTRINSIC
Pfam:zf-MYND	1008	1042	2.3e-7	PFAM
low complexity region	1075	1095	N/A	INTRINSIC
low complexity region	1162	1176	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109269
AA Change: R733*

SMART Domains

Protein: ENSMUSP00000104892
Gene: ENSMUSG00000039671
AA Change: R733*

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
low complexity region	41	60	N/A	INTRINSIC
PHD	94	135	2.23e-11	SMART
BROMO	151	258	1.77e-17	SMART
Pfam:PWWP	280	355	6.6e-11	PFAM
Pfam:DUF3544	417	626	2.6e-102	PFAM
internal_repeat_2	644	705	6.15e-5	PROSPERO
low complexity region	774	809	N/A	INTRINSIC
low complexity region	848	873	N/A	INTRINSIC
low complexity region	909	924	N/A	INTRINSIC
low complexity region	931	943	N/A	INTRINSIC
coiled coil region	972	1034	N/A	INTRINSIC
low complexity region	1111	1131	N/A	INTRINSIC
low complexity region	1198	1212	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152682

Predicted Effect

probably null
Transcript: ENSMUST00000170272
AA Change: R704*

SMART Domains

Protein: ENSMUSP00000128680
Gene: ENSMUSG00000039671
AA Change: R704*

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	37	56	N/A	INTRINSIC
PHD	65	106	2.23e-11	SMART
BROMO	122	229	1.77e-17	SMART
Pfam:PWWP	250	324	1.1e-11	PFAM
Pfam:DUF3544	387	599	1.9e-111	PFAM
internal_repeat_2	615	676	7.92e-5	PROSPERO
low complexity region	745	780	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC
low complexity region	850	862	N/A	INTRINSIC
coiled coil region	891	953	N/A	INTRINSIC
Pfam:zf-MYND	963	997	1.1e-6	PFAM
low complexity region	1030	1050	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000177633
AA Change: R724*

SMART Domains

Protein: ENSMUSP00000136211
Gene: ENSMUSG00000039671
AA Change: R724*

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	43	54	N/A	INTRINSIC
low complexity region	57	76	N/A	INTRINSIC
PHD	85	126	2.23e-11	SMART
BROMO	142	249	1.77e-17	SMART
Pfam:PWWP	270	344	9.6e-12	PFAM
Pfam:DUF3544	407	619	1.8e-111	PFAM
internal_repeat_2	635	696	6.45e-5	PROSPERO
low complexity region	765	800	N/A	INTRINSIC
low complexity region	848	863	N/A	INTRINSIC
low complexity region	870	882	N/A	INTRINSIC
coiled coil region	911	973	N/A	INTRINSIC
Pfam:zf-MYND	983	1017	6.7e-7	PFAM
low complexity region	1050	1070	N/A	INTRINSIC
low complexity region	1137	1151	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vps18	A	G	2: 119,297,228	Y844C	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het

Other mutations in Zmynd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01288:Zmynd8	APN	2	165812814	missense	probably damaging	1.00
IGL01311:Zmynd8	APN	2	165805209	missense	probably damaging	1.00
IGL02317:Zmynd8	APN	2	165820572	missense	possibly damaging	0.92
IGL02548:Zmynd8	APN	2	165833405	missense	probably damaging	1.00
IGL02798:Zmynd8	APN	2	165852150	critical splice acceptor site	probably null
IGL02933:Zmynd8	APN	2	165828318	missense	possibly damaging	0.65
cain	UTSW	2	165858053	critical splice donor site	probably null
F5770:Zmynd8	UTSW	2	165812394	nonsense	probably null
I1329:Zmynd8	UTSW	2	165828225	missense	probably damaging	1.00
P0031:Zmynd8	UTSW	2	165820698	splice site	probably benign
R0267:Zmynd8	UTSW	2	165828402	missense	probably damaging	1.00
R0608:Zmynd8	UTSW	2	165787158	splice site	probably null
R1663:Zmynd8	UTSW	2	165807885	missense	probably benign	0.11
R2212:Zmynd8	UTSW	2	165815451	missense	probably damaging	1.00
R3412:Zmynd8	UTSW	2	165815451	missense	probably damaging	1.00
R3413:Zmynd8	UTSW	2	165815451	missense	probably damaging	1.00
R3749:Zmynd8	UTSW	2	165805198	missense	probably damaging	1.00
R3820:Zmynd8	UTSW	2	165815461	nonsense	probably null
R3836:Zmynd8	UTSW	2	165858099	missense	probably benign	0.05
R3957:Zmynd8	UTSW	2	165812475	missense	probably damaging	0.99
R4379:Zmynd8	UTSW	2	165807938	splice site	probably null
R4526:Zmynd8	UTSW	2	165807607	intron	probably benign
R4739:Zmynd8	UTSW	2	165805329	missense	probably damaging	1.00
R4838:Zmynd8	UTSW	2	165840034	nonsense	probably null
R4932:Zmynd8	UTSW	2	165834951	missense	possibly damaging	0.90
R4933:Zmynd8	UTSW	2	165834951	missense	possibly damaging	0.90
R4997:Zmynd8	UTSW	2	165792816	missense	probably benign	0.01
R5652:Zmynd8	UTSW	2	165807698	missense	probably damaging	1.00
R5741:Zmynd8	UTSW	2	165840017	missense	probably damaging	1.00
R6008:Zmynd8	UTSW	2	165842787	missense	possibly damaging	0.77
R6242:Zmynd8	UTSW	2	165898947	missense	possibly damaging	0.91
R6332:Zmynd8	UTSW	2	165838852	missense	probably damaging	1.00
R6394:Zmynd8	UTSW	2	165846023	nonsense	probably null
R6772:Zmynd8	UTSW	2	165807601	missense	probably benign	0.35
R6970:Zmynd8	UTSW	2	165875750	missense	probably damaging	1.00
R6986:Zmynd8	UTSW	2	165833415	missense	probably damaging	1.00
R7229:Zmynd8	UTSW	2	165858053	critical splice donor site	probably null
R7266:Zmynd8	UTSW	2	165807572	missense	possibly damaging	0.49
R7296:Zmynd8	UTSW	2	165840009	missense	probably damaging	0.98
R7642:Zmynd8	UTSW	2	165812426	missense	probably damaging	1.00
R7818:Zmynd8	UTSW	2	165842831	missense	probably damaging	0.97
R7821:Zmynd8	UTSW	2	165881080	intron	probably benign
R8135:Zmynd8	UTSW	2	165812426	missense	probably damaging	1.00
R8828:Zmynd8	UTSW	2	165812546	missense	probably benign	0.00
R9128:Zmynd8	UTSW	2	165858138	start codon destroyed	probably null
R9200:Zmynd8	UTSW	2	165840085	missense	probably benign
R9345:Zmynd8	UTSW	2	165812748	missense	possibly damaging	0.85
R9478:Zmynd8	UTSW	2	165807649	missense	probably damaging	1.00
V7580:Zmynd8	UTSW	2	165812394	nonsense	probably null
V7581:Zmynd8	UTSW	2	165812394	nonsense	probably null
Z1088:Zmynd8	UTSW	2	165828171	missense	probably benign
Z1176:Zmynd8	UTSW	2	165828188	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTACCAATCTGGGACCCTGAGAC -3'
(R):5'- AGCGATTCCGAGGACTCCGAAAAG -3'

Sequencing Primer
(F):5'- CTGAGACATTCCCTGTCATAGTGG -3'
(R):5'- ACTCTCCTGTCAGCGAGAAG -3'

Posted On

2014-01-29