Incidental Mutation 'V7583:Sirpb1b'
ID 152637
Institutional Source Beutler Lab
Gene Symbol Sirpb1b
Ensembl Gene ENSMUSG00000095028
Gene Name signal-regulatory protein beta 1B
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # V7583 () of strain stinger
Quality Score 110
Status Not validated
Chromosome 3
Chromosomal Location 15495751-15575065 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15503183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 366 (V366A)
Ref Sequence ENSEMBL: ENSMUSP00000088869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091319] [ENSMUST00000192382]
AlphaFold A0A0A6YXN8
Predicted Effect probably benign
Transcript: ENSMUST00000091319
AA Change: V366A

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088869
Gene: ENSMUSG00000095028
AA Change: V366A

low complexity region 15 23 N/A INTRINSIC
IG 37 143 8.19e-9 SMART
IGc1 163 236 1.22e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192382
AA Change: V372A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142068
Gene: ENSMUSG00000095028
AA Change: V372A

signal peptide 1 26 N/A INTRINSIC
IG 37 143 3.3e-11 SMART
IGc1 163 236 5.1e-7 SMART
Pfam:C2-set_2 251 340 1e-4 PFAM
Pfam:Ig_2 251 348 2.7e-1 PFAM
Pfam:C1-set 258 341 1.3e-13 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Meta Mutation Damage Score 0.1521 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Sirpb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Sirpb1b APN 3 15548729 missense probably damaging 0.99
IGL01662:Sirpb1b APN 3 15543184 missense probably damaging 1.00
IGL02025:Sirpb1b APN 3 15548803 missense probably damaging 0.99
F5770:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
R0419:Sirpb1b UTSW 3 15548596 missense probably damaging 1.00
R1538:Sirpb1b UTSW 3 15548759 missense possibly damaging 0.81
R3935:Sirpb1b UTSW 3 15548783 missense probably benign 0.05
R4300:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4373:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4953:Sirpb1b UTSW 3 15548827 missense probably damaging 1.00
R5425:Sirpb1b UTSW 3 15548669 missense probably damaging 1.00
R6340:Sirpb1b UTSW 3 15548665 missense probably damaging 1.00
R6357:Sirpb1b UTSW 3 15503183 missense possibly damaging 0.79
R6723:Sirpb1b UTSW 3 15548798 missense possibly damaging 0.78
R7152:Sirpb1b UTSW 3 15542170 missense probably benign 0.25
R7390:Sirpb1b UTSW 3 15543040 nonsense probably null
R7411:Sirpb1b UTSW 3 15542997 missense probably benign 0.22
R7513:Sirpb1b UTSW 3 15542140 nonsense probably null
R7526:Sirpb1b UTSW 3 15548872 missense probably damaging 1.00
R8352:Sirpb1b UTSW 3 15542350 missense probably benign 0.03
R8452:Sirpb1b UTSW 3 15542350 missense probably benign 0.03
R8794:Sirpb1b UTSW 3 15548783 missense probably benign 0.05
R9165:Sirpb1b UTSW 3 15574904 missense probably damaging 1.00
Z1177:Sirpb1b UTSW 3 15574941 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tctatttattgacttcctctactccc -3'
Posted On 2014-01-29