Incidental Mutation 'V7583:Fcgr1'
ID 152638
Institutional Source Beutler Lab
Gene Symbol Fcgr1
Ensembl Gene ENSMUSG00000015947
Gene Name Fc receptor, IgG, high affinity I
Synonyms CD64, FcgammaRI
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock # V7583 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 96282909-96293969 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 96284276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 405 (*405W)
Ref Sequence ENSEMBL: ENSMUSP00000029748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029748]
AlphaFold P26151
Predicted Effect probably null
Transcript: ENSMUST00000029748
AA Change: *405W
SMART Domains Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: *405W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 111 1.8e-5 SMART
IGc2 125 184 6.11e-8 SMART
IG 206 290 7.3e-6 SMART
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200420
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Fcgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Fcgr1 APN 3 96284370 missense probably benign 0.01
IGL02142:Fcgr1 APN 3 96284577 missense probably benign 0.41
IGL03086:Fcgr1 APN 3 96284498 nonsense probably null
F5770:Fcgr1 UTSW 3 96284276 makesense probably null
FR4737:Fcgr1 UTSW 3 96284504 frame shift probably null
FR4737:Fcgr1 UTSW 3 96287094 missense probably benign 0.01
R0323:Fcgr1 UTSW 3 96285829 missense possibly damaging 0.84
R0594:Fcgr1 UTSW 3 96292312 missense probably damaging 1.00
R0926:Fcgr1 UTSW 3 96292366 missense possibly damaging 0.79
R1951:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1953:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1993:Fcgr1 UTSW 3 96285868 missense probably damaging 0.98
R2255:Fcgr1 UTSW 3 96285917 missense possibly damaging 0.88
R3941:Fcgr1 UTSW 3 96286033 missense probably benign 0.13
R4004:Fcgr1 UTSW 3 96284352 missense probably benign 0.00
R4409:Fcgr1 UTSW 3 96284577 missense probably benign 0.41
R5046:Fcgr1 UTSW 3 96286986 missense probably damaging 0.99
R5047:Fcgr1 UTSW 3 96285884 missense probably benign 0.38
R6970:Fcgr1 UTSW 3 96284620 critical splice acceptor site probably null
R7339:Fcgr1 UTSW 3 96284299 missense not run
R7992:Fcgr1 UTSW 3 96284581 missense probably benign 0.23
R8554:Fcgr1 UTSW 3 96292472 missense probably damaging 1.00
R9269:Fcgr1 UTSW 3 96285838 missense probably benign 0.01
R9396:Fcgr1 UTSW 3 96287074 nonsense probably null
V7581:Fcgr1 UTSW 3 96284276 makesense probably null
V7582:Fcgr1 UTSW 3 96284276 makesense probably null
X0028:Fcgr1 UTSW 3 96286027 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTCCGATGCTCTCAGGATGACCAC -3'
(R):5'- CTTTCAGCAAGTTAGAAGCGATGGC -3'

Sequencing Primer
(F):5'- TCTCAGACTGGAGTCTTCCAGAG -3'
(R):5'- CGTGTATGAAGAAGTAACAGCCAC -3'
Posted On 2014-01-29