Incidental Mutation 'V7583:Spaca1'
ID 152640
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Name sperm acrosome associated 1
Synonyms 1700124L11Rik, 4930540L03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # V7583 () of strain stinger
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 34024874-34050191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34039311 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 192 (E192G)
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734] [ENSMUST00000108148]
AlphaFold Q9DA48
Predicted Effect probably damaging
Transcript: ENSMUST00000029927
AA Change: E192G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264
AA Change: E192G

signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084734
AA Change: E192G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264
AA Change: E192G

signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108148
AA Change: E74G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103783
Gene: ENSMUSG00000028264
AA Change: E74G

transmembrane domain 109 131 N/A INTRINSIC
Meta Mutation Damage Score 0.1651 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34029077 missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34040894 missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34049838 small insertion probably benign
FR4548:Spaca1 UTSW 4 34049856 small insertion probably benign
FR4737:Spaca1 UTSW 4 34049836 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049844 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049849 small insertion probably benign
R0377:Spaca1 UTSW 4 34044267 splice site probably null
R1861:Spaca1 UTSW 4 34044206 missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34028468 missense probably damaging 1.00
R4930:Spaca1 UTSW 4 34044236 missense possibly damaging 0.65
R5030:Spaca1 UTSW 4 34039247 missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34029095 missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34049863 missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34029176 missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34049869 missense probably benign 0.00
R8039:Spaca1 UTSW 4 34044207 missense probably damaging 0.99
R8094:Spaca1 UTSW 4 34049837 missense possibly damaging 0.55
R8134:Spaca1 UTSW 4 34042157 splice site probably null
R9120:Spaca1 UTSW 4 34029168 missense probably damaging 0.97
RF006:Spaca1 UTSW 4 34049853 small insertion probably benign
RF017:Spaca1 UTSW 4 34049853 small insertion probably benign
RF032:Spaca1 UTSW 4 34049854 small insertion probably benign
RF043:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049854 small insertion probably benign
RF060:Spaca1 UTSW 4 34049841 small insertion probably benign
V7580:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7581:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7582:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- actaagtcagaagctctagtgtg -3'
Posted On 2014-01-29